Kevin Wyllie Week 3

From LMU BioDB 2015
Revision as of 18:37, 21 September 2015 by Kwyllie (Talk | contribs) (Included the entire translated sequence (instead of stopping at stop codons), as instructed in the Week 2 feedback.)

Jump to: navigation, search

Complement of a Strand

Kwscreenshot1.jpg
  • Shown in green: the following command is used to open the file (using prokaryote.txt as an example).
cat prokaryote.txt
  • Shown in red: the following command is used to sequence the complementary strand (in the 5' -> 3' direction - thus the "rev" command).
cat prokaryote.txt | sed "y/atgc/tacg/" | rev
  • These commands yield the nucleotide sequence:
    • 5'- gttaaaatgccgccagcggaactggcggctgggttatacgcggaacatggtattaggcaacgtttcaagttcaatattgtcttctttggccatcgtacctattgaaatatagtaga -3'

Reading Frames

The original sequence in the prokaryote.txt file will be assumed to be the top strand for this exercise.

+1, +2, and +3 Frames

Kwscreenshot2.jpg
  • Shown in green: to separate the strand into codons (resulting in the +1 frame):
cat prokaryote.txt | sed "s/.../& /g"
  • Shown in red: to convert to the mRNA sequence (treating the DNA strand as the mRNA-like strand):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/"
  • Shown in blue: to translate this mRNA sequence (yielding the +1 frame):
cat prokaryote.txt | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
  • For the +2 frame, the final pipe can be slightly altered:
cat prokaryote.txt | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
  • And similarly, for the +3 frame:
cat prokaryote.txt | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed


Kwscreenshot3.jpg
  • These pipes yield the following amino acid sequences (shown on right):
    • +1 Nter- S T I F Q - V R W P K K T I L N L K R C L I P C S A Y N P A A S S A G G I L -Cter (shown in red)
    • +2 Nter- L L Y F N R Y D G Q R R Q Y - T - N V A - Y H V P R I T Q P P V P L A A F -Cter (shown in green)
    • +3 Nter- Y Y I S I G T M A K E D N I E L E T L P N T M F R V - P S R Q F R W R H F N -Cter (shown in blue)





-1, -2, and -3 Frames

  • For the -1 frame, open the file as usual, and then use the pipe from "Complement of a Strand" so that the commands after it will be applied to the complementary strand (instead of the original strand). Then, add the same pipe used for the +1 strand:
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
  • As before, the -2 and -3 frames can be found by making a single adjustment to the pipe for the -1 frame. For the -2 frame:
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^.//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
  • And for the -3 frame:
cat prokaryote.txt | sed "y/atgc/tacg/" | rev | sed "s/^..//g" | sed "s/.../& /g" | sed "y/t/u/" | sed -f genetic-code.sed
Kwscreenshot4.jpg
  • These pipes yield the following amino acid sequences (shown on right):
    • -1 Nter- V K M P P A E L A A G L Y A E H G I R Q R F K F N I V F F G H R T Y - N I V -Cter (shown in red)
    • -2 Nter- L K C R Q R N W R L G Y T R N M V L G N V S S S I L S S L A I V P I E I - - -Cter (shown in green)
    • -3 Nter - - N A A S G T G G W V I R G T W Y - A T F Q V Q Y C L L W P S Y L L K Y S R - Cter. (shown in blue)




XMLPipeDB Match Practice

Kwscreenshot5.jpg
  • To count the occurrence of GO:0005, GO:0006, and GO:0007 (shown on right):
cat 493.P_falciparum.xml | java -jar xmlpipedb-match-1.1.1.jar "GO:000[567]"
  • There are three unique matches (the maximum possible for this command).
    • GO:0005 occurred 1,371 times.
    • GO:0006 occurred 1,100 times.
    • GO:0007 occurred 113 times.



Kwscreenshot6.jpg
  • To find GO:0007 "in situ" (shown on right):
grep "GO:0007" 493.P_falciparum.xml
  • Looking at the text found on the same lines as this pattern, it appears to be the first few characters of a gene ID. Based on prior knowledge, it also may have something to do with gene ontology, as I have seen "GO" as an acronym for that term before.



Kwscreenshot7.jpg
  • To count the occurrence of \"Yu.*\" (shown on right):
cat "493.P_falciparum.xml" | java -jar xmlpipedb-match-1.1.1.jar "\"Yu.*\""
  • There are three unique matches.
    • "yu b." occurred one time.
    • "yu k." occurred 228 times.
    • "yu m." occurred one time.
  • A grep command for this pattern brings up lines such as:
<person name="Yu K."/>

So these may be names of biologists, perhaps those who were responsible for the discovery of a given gene.



Kwscreenshot8.jpg
  • To count occurrence of of "ATG."
    • The match function finds 830,101 matches in hs_ref_GRCh37_chr19.fa (shown on right, in green).
    • Connecting grep to wc finds 502,410 lines, 502,410 words and 35,671,048 characters (shown on right, in red).
    • This discrepancy in matches is due to the differences in the functions. The Match function looks for the pattern outright, while grep-wc looks at the entirety of any line in which the pattern is found. The numbers that grep-wc returns apply to the lines that "ATG" is found in, not just the "ATG" pattern itself.