Malverso Week 4
From LMU BioDB 2015
Contents
Transcription and Translation "Taken to the Next Level"
I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data. I added line breaks in the sequences and commands when necessary to enhance readability.
#1
-35 box of the promoter
- Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.
- Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1"
| sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"
This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code:
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"
Which produces:
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac gctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcccgctcccttatac gttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgc aaatc<minus35box>tttact</minus35box>tatttacagaacttcggcattatcttgccggttcaaatt acggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgt tgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgca aaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgca ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc ggcctttttattttat
-10 box of the promoter
- By figuring out which -35 box tags were correct I also figured out which -10 box tags were correct. I added more line breaks to make this clear, and used the code below to produce the code with the correct -10 box tags and correct -35 box tags:
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1"
| sed -r "2s/^(.){17}/&\n/g" | sed "3s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"
Which returned:
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacg ctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacg ttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaa atc<minus35box>tttact</minus35box> tatttacagaacttcgg <minus10box>cattat</minus10box>cttgccggttcaaattacggtagtgataccccagaggattagatg gccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttag aaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaa agtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgc ctgatgggcgaagagaaagaacgagtaaaaggtcggtttaaccggcctttttattttat
transcription start site
- It was given that the tss is at the 12th nucleotide after the first nucleotide of the -10 box. I put a line break after the -10 box and then used the sed command: sed -r "4s/^(.){6}/&<tss>/g" to tag the beginning of the tss. Since the -10 box is 6 nucleotides, I put the tss tag before the 6th character after the line break. I wasn't sure if it should be at the 6th or 7th character after, so I asked Mahrad.
This sed command, however, is not at helpful to tag the end of the tss. In order to tag both the beginning and the end of the location, I changed the command to:
cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1"
| sed -r "2s/^(.){17}/&\n/g" | sed "3s/[ct]at[at]at/<minus10box>&<\/minus10box>\n/g"
| sed -r "4s/^(.){5}/&\n/g" | sed "5s/^./<tss>&<\/tss>/g"
This way, the nucleotide that was at the tss location would be at the beginning of the line, and I could easily surround it with the appropriate tags, as shown below:
ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttacg ctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcaccgctcccttatacg ttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgcaa atc<minus35box>tttact</minus35box> tatttacagaacttcgg <minus10box>cattat</minus10box> cttgc <tss>c</tss>ggttcaaattacggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgc aaggtaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcaca catctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtac gacctgagcaaaggccgcattgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgag taaaaggtcggtttaaccggcctttttattttat
Team Page
Assignments
- Week 1
- Week 2
- Week 3
- Week 4
- Week 5
- Week 6
- Week 7
- Week 8
- Week 9
- Week 10
- Week 11
- Week 12
- Week 13
- Week 14
- Week 15
Individual Journal Entries
- Malverso User Page (Week 1)
- Week 2
- Week 3
- Week 4
- Week 5
- Week 6
- Week 7
- Week 8
- Week 9
- Week 10
- Week 11
- Week 12
- Week 13
- Week 14
- Week 15
