Malverso Week 4

Transcription and Translation "Taken to the Next Level"

I completed this assignment using Putty.exe by accessing infA-E.coli-K12.txt in ~dondi/xmlpipedb/data.

#1

-35 box of the promoter

• Looking over my notes of when I first attempted this assignment in class, I used the sed command to find all the places where the pattern tt[gt]ac[at] occurred and attached a <minus35box> tag to the beginning of that sequence and a </minus35box> to the end. This resulted with two possible locations for the -35 box being tagged.
• Since it was given that there were 17 base pairs between the -35 box and the -10 box, I used that clue to identify which -35 box tags were correct, as well as a bit pf guess and check. I just assumed the first -35 box tag was correct and modified my sed command to only tag the first instance of the -35 box pattern by replacing the g at the end with a 1. I also added an \n to the end of the box tags so that a new line would start after the last -35 box tag. Referring back to my in class notes, I added a sed command on to search for the base pair possibilities for the -10 box as well as a command that would show me the point after 17 characters from the end of my -35 box:

cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>\n/1" | sed -r "2s/^(.){17}/&<here?>/g" | sed "s/[ct]at[at]at/<minus10box>&<\/minus10box>/g"

This confirmed that the first instance of the -35 box pattern match was the correct one. To calculate just where the -35 box is, I can now use the code:

cat infA-E.coli-K12.txt |sed "s/tt[gt]ac[at]/<minus35box>&<\/minus35box>/1"

Which produces:(The below sequence includes line breaks for readability)

ttttcaccacaagaatgaatgttttcggcacatttctccccagagtgttataattgcggtcgcagagttggttac
gctcattaccccgctgccgataaggaatttttcgcgtcaggtaacgcccatcgtttatctcccgctcccttatac
gttgcgcttttggtgcggcttagccgtgtgttttcggagtaatgtgccgaacctgtttgttgcgatttagcgcgc
aaatc<minus35box>tttact</minus35box>tatttacagaacttcggcattatcttgccggttcaaatt
acggtagtgataccccagaggattagatggccaaagaagacaatattgaaatgcaaggtaccgttcttgaaacgt
tgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgca
aaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgca
ttgtcttccgtagtcgctgattgttttaccgcctgatgggcgaagagaaagaacgagtaaaaggtcggtttaacc
ggcctttttattttat

Team Page

Heavy Metal HaterZ

Assignments

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 13
• Week 14
• Week 15

Individual Journal Entries

• Malverso User Page (Week 1)
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 13
• Week 14
• Week 15

Shared Journal Entries

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 13
• Week 14
• Week 15