Bhamilton18 Week 2

Bhamilton18 Electronic Notebook

Genetic Code

Original Strand:

5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Complementary Strand:

3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'

RNA Strand:

5'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1)

3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' (Strand 2)

Reading Frames

Reading Frame +1

5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'

Reading Frame + 2

5'-V-S-Stop|-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'

Reading Frame +3:

5'-Y-A-N-T-M-F-R-V-Stop|-P-S-R-Q-F-R-W-R-H-F-3'

Reading Frame -1

3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop|-N-5'

Reading Frame -2

3'-H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K-5'

Reading Frame -3

3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5'

Typically with the "STOP" codon the gene is no longer translated; however, for the purposes of this exercise I translated the rest of the RNA into the respective amino acid.

The following readings frames are: open reading frames: +1, -2, -3

Category	Links
User Page	Blair Hamilton
Weekly Assignments	Bhamilton18 Week 2   Bhamilton18 Week 3   Bhamilton18 Week 4  Animal QTL  Bhamilton18 Week 6  Bhamilton18 Week 7  Bhamilton18 Week 8  Bhamilton18 Week 9  Bhamilton18 Week 10  Bhamilton18 Week 11  Bhamilton18 Week 12  Bhamilton18 Week 14  Bhamilton18 Week 15
Weekly Assignment Instructions	Week 1   Week 2   Week 3   Week 4   Week 5   Week 6   Week 7   Week 8   Week 9   Week 10   Week 11   Week 12   Week 14   Week 15
Class Journals	Class Journal Week 1   Class Journal Week 2   Class Journal Week 3   Class Journal Week 4   Class Journal Week 5   Class Journal Week 6   Class Journal Week 7   Class Journal Week 8   Class Journal Week 9   Class Journal Week 10
Final Project	Lights, Camera, InterACTION!  Lights, Camera, InterACTION! Deliverables

Acknowledgements

I collaborated with Antonio Porras on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA, reading frames, and open reading frames together.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Bhamilton18 (talk) 10:01, 9 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2

Genetic code. (2017, August 31). Retrieved September 09, 2017, from https://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table