Difference between revisions of "Hhinsch Week 3"
(changed the references a bit(the formatting of the link to the dynamic text processing page)) |
(changed my references so you can see the w3sschools website i used without clicking on the link) |
||
(2 intermediate revisions by the same user not shown) | |||
Line 12: | Line 12: | ||
#Yes there are links to other pages within the ExPASy translation server's responses. <code>/css/sib_css/sib.css</code> <code>/css/sib_css/sib_print.css</code> and <code>/css/base.css</code> are some of the links to other pages within the ExPASy translation server which take care of the visual aspect of the page. There are some other links to other servers that complete different operations. | #Yes there are links to other pages within the ExPASy translation server's responses. <code>/css/sib_css/sib.css</code> <code>/css/sib_css/sib_print.css</code> and <code>/css/base.css</code> are some of the links to other pages within the ExPASy translation server which take care of the visual aspect of the page. There are some other links to other servers that complete different operations. | ||
#I noticed a few identifiers: | #I noticed a few identifiers: | ||
+ | <code> | ||
*id='sib_top' | *id='sib_top' | ||
*id='sib_container' | *id='sib_container' | ||
Line 25: | Line 26: | ||
*id = "sib_footer_right" | *id = "sib_footer_right" | ||
*id = "sib_footer_gototop" | *id = "sib_footer_gototop" | ||
+ | </code> | ||
These serve as small descriptions of what is being identified, for example: id="sib_expasy_logo" is identifying the eXPASy logo. | These serve as small descriptions of what is being identified, for example: id="sib_expasy_logo" is identifying the eXPASy logo. | ||
− | |||
===The sequence of commands that extracts “just the answers” from the raw-data response=== | ===The sequence of commands that extracts “just the answers” from the raw-data response=== | ||
<code>curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'</code> | <code>curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'</code> | ||
− | + | ===Electronic Notebook=== | |
+ | [[hhinsch Electronic Notebook]] | ||
===Acknowledgements=== | ===Acknowledgements=== | ||
#I worked with both [[User:ebachour|Eddie Bachoura]] and [[User:Zvanysse|Zachary Van Ysseldyk]] in person and over text to collaborate and come up with my answers. | #I worked with both [[User:ebachour|Eddie Bachoura]] and [[User:Zvanysse|Zachary Van Ysseldyk]] in person and over text to collaborate and come up with my answers. | ||
Line 39: | Line 41: | ||
#I used the [[Dynamic Text Processing]] page to get a firmer grasp on using sed. | #I used the [[Dynamic Text Processing]] page to get a firmer grasp on using sed. | ||
#I used [[The Web from the Command Line]] page to get a firmer grasp on curl. | #I used [[The Web from the Command Line]] page to get a firmer grasp on curl. | ||
− | #I used [https://www.w3schools.com/tags/tag_div.asp this] web developer site to find identifiers in the code. | + | #I used [https://www.w3schools.com/tags/tag_div.asp this] web developer site(<code>https://www.w3schools.com/tags/tag_div.asp</code>) to find identifiers in the code. |
#I used the [[Week 3]] assignment page: <code>https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3</code> multiple times to clarify the questions being asked and to access the pages mentioned above. | #I used the [[Week 3]] assignment page: <code>https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3</code> multiple times to clarify the questions being asked and to access the pages mentioned above. | ||
{{Template:hhinsch}} | {{Template:hhinsch}} |
Latest revision as of 06:40, 20 September 2017
Contents
- 1 Hhinsch Week 3 Individual Journal Entry
- 1.1 Screen Shot of Text and Image 'Hack' With Developer Tools Open
- 1.2 Screen Shot of Text and Image 'Hack' With Developer Tools Closed
- 1.3 The curl command that requests a translation at the command-line, raw-data level
- 1.4 Answers to the two questions regarding the ExPASy translation server’s output
- 1.5 The sequence of commands that extracts “just the answers” from the raw-data response
- 1.6 Electronic Notebook
- 1.7 Acknowledgements
- 1.8 References
- 1.9 Assignments
- 1.10 Hayden's Individual Journal Entries
- 1.11 Class Journal Entries
- 1.12 Electronic Notebook
- 1.13 Hayden's User Page
Hhinsch Week 3 Individual Journal Entry
Screen Shot of Text and Image 'Hack' With Developer Tools Open
Screen Shot of Text and Image 'Hack' With Developer Tools Closed
The curl command that requests a translation at the command-line, raw-data level
curl -d "submit=Submit&pre_text=actgcttcggtacagtcagatcgactacgaccccattcagtc" http://web.expasy.org/cgi-bin/translate/dna_aa
Answers to the two questions regarding the ExPASy translation server’s output
- Yes there are links to other pages within the ExPASy translation server's responses.
/css/sib_css/sib.css
/css/sib_css/sib_print.css
and/css/base.css
are some of the links to other pages within the ExPASy translation server which take care of the visual aspect of the page. There are some other links to other servers that complete different operations. - I noticed a few identifiers:
- id='sib_top'
- id='sib_container'
- id='sib_header_small'
- id="sib_expasy_logo"
- id="sib_link"
- id="expasy_link"
- id='resource_header'
- id='sib_header_nav'
- d='sib_body'
- id = 'sib_footer'
- id = 'sib_footer_content'
- id = "sib_footer_right"
- id = "sib_footer_gototop"
These serve as small descriptions of what is being identified, for example: id="sib_expasy_logo" is identifying the eXPASy logo.
The sequence of commands that extracts “just the answers” from the raw-data response
curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'
Electronic Notebook
Acknowledgements
- I worked with both Eddie Bachoura and Zachary Van Ysseldyk in person and over text to collaborate and come up with my answers.
- Zachary Van Ysseldyk helped me after class to utilize the sed and grep commands in order to eliminate the unwanted code.
- While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.Hhinsch (talk) 22:30, 19 September 2017 (PDT)
References
- I used the Dynamic Text Processing page to get a firmer grasp on using sed.
- I used The Web from the Command Line page to get a firmer grasp on curl.
- I used this web developer site(
https://www.w3schools.com/tags/tag_div.asp
) to find identifiers in the code. - I used the Week 3 assignment page:
https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
multiple times to clarify the questions being asked and to access the pages mentioned above.
Assignments
Week 1
Week 2
Week 3
Week 4
Week 5
Week 6
Week 7
Week 8
Week 9
Week 10
Week 11
Week 12
Week 14
Week 15
Hayden's Individual Journal Entries
hhinsch Week 1
hhinsch Week 2
hhinsch Week 3
hhinsch Week 4
hhinsch Week 5
hhinsch Week 6
hhinsch Week 7
hhinsch Week 8
hhinsch Week 9
hhinsch Week 10
hhinsch Week 11
hhinsch Week 12
hhinsch Week 14
hhinsch Week 15
Page Desiigner Deliverables Page
Class Journal Entries
Class Journal Week 1
Class Journal Week 2
Class Journal Week 3
Class Journal Week 4
Class Journal Week 5
Class Journal Week 6
Class Journal Week 7
Class Journal Week 8
Class Journal Week 9
Class Journal Week 10
Page Desiigner