Difference between revisions of "Bhamilton18 Week 2"

From LMU BioDB 2017
Jump to: navigation, search
(Copying from Electronic Notebook)
(Fixed the references spacing)
 
(4 intermediate revisions by the same user not shown)
Line 25: Line 25:
 
'''Reading Frame + 2'''
 
'''Reading Frame + 2'''
  
  5'-V-S-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'
+
  5'-V-S-Stop|-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'
  
 
'''Reading Frame +3:'''  
 
'''Reading Frame +3:'''  
  
  5'-Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F-3'
+
  5'-Y-A-N-T-M-F-R-V-Stop|-P-S-R-Q-F-R-W-R-H-F-3'
  
 
'''Reading Frame -1'''
 
'''Reading Frame -1'''
  
  3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N-5'
+
  3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop|-N-5'
 
   
 
   
 
'''Reading Frame -2'''
 
'''Reading Frame -2'''
Line 42: Line 42:
  
 
  3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5'
 
  3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5'
 +
 +
<br>
 +
'''Typically with the "STOP" codon the gene is no longer translated; however, for the purposes of this exercise I translated the rest of the RNA into the respective amino acid.'''
  
 
<br>
 
<br>
 
The following readings frames are: '''open reading frames:''' +1, -2, -3 <!--These strands do not contain a "stop" codon-->
 
The following readings frames are: '''open reading frames:''' +1, -2, -3 <!--These strands do not contain a "stop" codon-->
  
{{Template:Bhamilton18 Journal Entries}}
+
{{Template:Bhamilton18}}
  
 
== Acknowledgements ==
 
== Acknowledgements ==
  
I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together.
+
I collaborated with [[User:Aporras1| Antonio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA, reading frames, and open reading frames together.
  
 
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''
 
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.'''
Line 58: Line 61:
  
 
LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 
LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
 +
 +
Genetic code. (2017, August 31). Retrieved September 09, 2017, from https://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table
  
 
[[Category: Journal Entry]]
 
[[Category: Journal Entry]]

Latest revision as of 04:24, 26 September 2017

Bhamilton18 Electronic Notebook

Genetic Code

Original Strand:

5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Complementary Strand:

3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'

RNA Strand:

5'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1)
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' (Strand 2)

Reading Frames

Reading Frame +1

5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'

Reading Frame + 2

5'-V-S-Stop|-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'

Reading Frame +3:

5'-Y-A-N-T-M-F-R-V-Stop|-P-S-R-Q-F-R-W-R-H-F-3'

Reading Frame -1

3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop|-N-5'

Reading Frame -2

3'-H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K-5'

Reading Frame -3

3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5'


Typically with the "STOP" codon the gene is no longer translated; however, for the purposes of this exercise I translated the rest of the RNA into the respective amino acid.


The following readings frames are: open reading frames: +1, -2, -3


Category Links
User Page Blair Hamilton
Weekly Assignments Bhamilton18 Week 2Bhamilton18 Week 3Bhamilton18 Week 4Animal QTLBhamilton18 Week 6Bhamilton18 Week 7Bhamilton18 Week 8Bhamilton18 Week 9Bhamilton18 Week 10Bhamilton18 Week 11Bhamilton18 Week 12Bhamilton18 Week 14Bhamilton18 Week 15
Weekly Assignment
Instructions
Week 1Week 2Week 3Week 4Week 5Week 6Week 7Week 8Week 9Week 10Week 11Week 12Week 14Week 15
Class Journals Class Journal Week 1Class Journal Week 2Class Journal Week 3Class Journal Week 4Class Journal Week 5Class Journal Week 6Class Journal Week 7Class Journal Week 8Class Journal Week 9Class Journal Week 10
Final Project Lights, Camera, InterACTION!Lights, Camera, InterACTION! Deliverables

Acknowledgements

I collaborated with Antonio Porras on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA, reading frames, and open reading frames together.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Bhamilton18 (talk) 10:01, 9 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2

Genetic code. (2017, August 31). Retrieved September 09, 2017, from https://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table