Difference between revisions of "Bhamilton18 Week 2"
Bhamilton18 (talk | contribs) (Copying from Electronic Notebook) |
Bhamilton18 (talk | contribs) (Stop codon clarification) |
||
Line 25: | Line 25: | ||
'''Reading Frame + 2''' | '''Reading Frame + 2''' | ||
− | 5'-V-S-Stop-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3' | + | 5'-V-S-Stop|-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3' |
'''Reading Frame +3:''' | '''Reading Frame +3:''' | ||
− | 5'-Y-A-N-T-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F-3' | + | 5'-Y-A-N-T-M-F-R-V-Stop|-P-S-R-Q-F-R-W-R-H-F-3' |
'''Reading Frame -1''' | '''Reading Frame -1''' | ||
− | 3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N-5' | + | 3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop|-N-5' |
'''Reading Frame -2''' | '''Reading Frame -2''' | ||
Line 42: | Line 42: | ||
3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5' | 3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5' | ||
+ | |||
+ | <br> | ||
+ | '''Typically with the "STOP" codon the gene is no longer translated; however, for the purposes of this exercise I translated the rest of the RNA into the respective amino acid.''' | ||
<br> | <br> |
Revision as of 03:47, 12 September 2017
Bhamilton18 Electronic Notebook
Contents
Genetic Code
Original Strand:
5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Complementary Strand:
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'
RNA Strand:
5'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1)
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' (Strand 2)
Reading Frames
Reading Frame +1
5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L-3'
Reading Frame + 2
5'-V-S-Stop|-Y-H-V-P-R-I-T-Q-P-P-V-P-L-A-A-F-3'
Reading Frame +3:
5'-Y-A-N-T-M-F-R-V-Stop|-P-S-R-Q-F-R-W-R-H-F-3'
Reading Frame -1
3'-A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop|-N-5'
Reading Frame -2
3'-H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K-5'
Reading Frame -3
3'-I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K-5'
Typically with the "STOP" codon the gene is no longer translated; however, for the purposes of this exercise I translated the rest of the RNA into the respective amino acid.
The following readings frames are: open reading frames: +1, -2, -3
User Page: Blair Hamilton
Assignments
Individual Journal Entries
Week 1 Blair Hamilton
Bhamilton18 Week 2
Class Journal Week 1
Class Journal Week 2
Acknowledgements
I collaborated with Antionio Porras on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Bhamilton18 (talk) 10:01, 9 September 2017 (PDT)
References
LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2