Difference between revisions of "Hhinsch Week 3"
From LMU BioDB 2017
(edited my first and second answers) |
(added the sequence of commands that extracts just the answers) |
||
| Line 26: | Line 26: | ||
*id = "sib_footer_gototop" | *id = "sib_footer_gototop" | ||
These serve as small descriptions of what is being identified, for example: id="sib_expasy_logo" is identifying the eXPASy logo. | These serve as small descriptions of what is being identified, for example: id="sib_expasy_logo" is identifying the eXPASy logo. | ||
| + | |||
| + | |||
| + | ===The sequence of commands that extracts “just the answers” from the raw-data response=== | ||
| + | <code>curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'</code> | ||
Revision as of 05:18, 20 September 2017
Contents
- 1 Hhinsch Week 3 Individual Journal Entry
- 1.1 Screen Shot of Text and Image 'Hack' With Developer Tools Open
- 1.2 Screen Shot of Text and Image 'Hack' With Developer Tools Closed
- 1.3 The curl command that requests a translation at the command-line, raw-data level
- 1.4 Answers to the two questions regarding the ExPASy translation server’s output
- 1.5 The sequence of commands that extracts “just the answers” from the raw-data response
Hhinsch Week 3 Individual Journal Entry
Screen Shot of Text and Image 'Hack' With Developer Tools Open
Screen Shot of Text and Image 'Hack' With Developer Tools Closed
The curl command that requests a translation at the command-line, raw-data level
curl -d "submit=Submit&pre_text=actgcttcggtacagtcagatcgactacgaccccattcagtc" http://web.expasy.org/cgi-bin/translate/dna_aa
Answers to the two questions regarding the ExPASy translation server’s output
- Yes there are links to other pages within the ExPASy translation server's responses.
/css/sib_css/sib.css/css/sib_css/sib_print.cssand/css/base.cssare some of the links to other pages within the ExPASy translation server which take care of the visual aspect of the page. There are some other links to other servers that complete different operations. - I noticed a few identifiers:
- id='sib_top'
- id='sib_container'
- id='sib_header_small'
- id="sib_expasy_logo"
- id="sib_link"
- id="expasy_link"
- id='resource_header'
- id='sib_header_nav'
- d='sib_body'
- id = 'sib_footer'
- id = 'sib_footer_content'
- id = "sib_footer_right"
- id = "sib_footer_gototop"
These serve as small descriptions of what is being identified, for example: id="sib_expasy_logo" is identifying the eXPASy logo.
The sequence of commands that extracts “just the answers” from the raw-data response
curl "http://web.expasy.org/cgi-bin/translate/dna_aa?pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard" | grep -E '<(BR|PRE)>' | sed 's/<[^>]*>//g'
