Difference between revisions of "Bhamilton18 Week 2"
From LMU BioDB 2017
Bhamilton18 (talk | contribs) (RNA Strand) |
Bhamilton18 (talk | contribs) (Added Notebook) |
||
| Line 1: | Line 1: | ||
| + | [[Bhamilton18 Electronic Notebook]] | ||
==Genetic Code== | ==Genetic Code== | ||
| Line 12: | Line 13: | ||
'''RNA Strand:''' | '''RNA Strand:''' | ||
| − | 3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' | + | 5'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1) |
| + | |||
| + | 3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' (Strand 2) | ||
| + | |||
| + | ===Reading Frames=== | ||
| + | |||
| + | '''Reading Frame +1''' | ||
| + | |||
| + | 5'- R- | ||
{{Template:Bhamilton18 Journal Entries}} | {{Template:Bhamilton18 Journal Entries}} | ||
| Line 18: | Line 27: | ||
== Acknowledgements == | == Acknowledgements == | ||
| − | I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging. We worked on | + | I collaborated with [[User:Aporras1| Antionio Porras]] on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together. |
'''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.''' | '''While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.''' | ||
Revision as of 22:27, 9 September 2017
Bhamilton18 Electronic Notebook
Contents
Genetic Code
Original Strand:
5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Complementary Strand:
3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'
RNA Strand:
5'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1)
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' (Strand 2)
Reading Frames
Reading Frame +1
5'- R-
User Page: Blair Hamilton
Assignments
Individual Journal Entries
Week 1 Blair Hamilton
Bhamilton18 Week 2
Class Journal Week 1
Class Journal Week 2
Acknowledgements
I collaborated with Antionio Porras on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
Bhamilton18 (talk) 10:01, 9 September 2017 (PDT)
References
LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2
