Bhamilton18 Week 2

From LMU BioDB 2017
Revision as of 22:27, 9 September 2017 by Bhamilton18 (talk | contribs) (Added Notebook)
Jump to: navigation, search

Bhamilton18 Electronic Notebook

Genetic Code

Original Strand:

5'-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Complementary Strand:

3'-gcatacgattatggtacaaggcgcatattgggtcggcggtcaaggcgaccgccgtaaaat-5'

RNA Strand:

5'-cgu aug cuaauaccauguuccgcguauaacccagccgccaguuccgcuggcggcauuuua-3’ (Strand 1)
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau-5' (Strand 2)

Reading Frames

Reading Frame +1

5'- R-

User Page: Blair Hamilton

Assignments

Week 1
Week 2

Individual Journal Entries

Week 1 Blair Hamilton
Bhamilton18 Week 2

Shared Journal Entries

Class Journal Week 1
Class Journal Week 2

Acknowledgements

I collaborated with Antionio Porras on this assignment. We communicated through texting/messaging and met in person. We worked on how to decode the DNA, RNA and reading frames together.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

Bhamilton18 (talk) 10:01, 9 September 2017 (PDT)

References

LMU BioDB 2017. (2017). Week 2. Retrieved September 5, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_2