Week 2 Individual Journal
Jump to navigation
Jump to search
Contents
- 1 Purpose
- 2 Materials and Methods
- 3 Results
- 3.1 a) What are the differences in the DNA sequences of the alleles you defined in Part I.
- 3.2 b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.
- 3.3 c) Which DNA sequences are found in each of the four starting organisms?
- 3.4 d) Using this knowledge, construct a pure-breeding purple organism.
- 3.5 e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?
- 3.6 f) Try making this protein: MLVKEIAMYRFATHER
- 4 Conclusion
- 5 Acknowledgements
- 6 References
Purpose
- Differentiate the DNA sequence of different plant alleles
- Determine the relationship between the DNA sequence of plant alleles and the expression of their pigment proteins
- Determine how these plant alleles interact with one another
- Create an allele that expresses a purple protein
Materials and Methods
- Cross bred phenotypically different plants to produce purple colored plants
- Created purple pigment protein
- Compared the DNA sequence of different plant pigment alleles with Aipotu
- Compared the amino acid sequence of the different plant pigment alleles
- Sequenced the primary structure of purple pigment protein
- genetically altered white pigment allele to a DNA sequence that corresponded to the amino acid sequence of the purple pigment protein
Results
a) What are the differences in the DNA sequences of the alleles you defined in Part I.
- allele color: Blue vs yellow
- change(s) in amino acid sequence: Tyr for Trp
- change(s) in DNA sequence: 79 (A for G), 80 (C for G)
- allele color: Red vs White
- change(s) in amino acid sequence: no mRNA for white allele
- change(s) in DNA sequence: 9 (A for G)
- allele color: Red vs Blue
- change(s) in amino acid sequence: Phe for Try
- change(s) in DNA sequence: 79 (T for A)
- allele color: Red vs Yellow
- change(s) in amino acid sequence: Phe for Trp
- change(s) in DNA sequence: 79 (T for G), 80 (C for G)
- allele color: Green vs Red
- change(s) in amino acid sequence: Trp for Cys, Tyr for Phe
- change(s) in DNA sequence: 79 (A for T), 83 (G for T)
Yes, they have the same sequence because they are the same allele.
c) Which DNA sequences are found in each of the four starting organisms?
- White
CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACCAGACAGCCGTCATCATCCCCCGCA
- Red
CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACAAGACAGCCGTCATCATCCCCCGCA
- Green 1
AGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACCGCCGTCATCATCCCCCGCA
- Green 2
CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACAGCCGTCATCATCCCCCGCA
d) Using this knowledge, construct a pure-breeding purple organism.
Protein Sequence: Met Ser Asn Arg His Ile Leu Leu Val Val Tyr Phe Cys Arg Gln
Allele 1:
CAGCTATAA ATGTCTAACAGACATATTCTCCTCGTCGTCTATTTTTGTCGTCAT GGGGGCGT GTCGATATT TACAGATTGTCTGTATAAGAGGAGCAGCAGATAAAAACAGCAGTA CCCCCGCA
Allele 2:
CAGCTATAA ATGTCTAACAGACATATTCTCCTCGTCGTCTATTTTTGTCGTCAT GGGGGCGT GTCGATATT TACAGATTGTCTGTATAAGAGGAGCAGCAGATAAAAACAGCAGTA CCCCCGCA
e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?
- According to the Central Dogma of Biology, genetic information is carried from DNA to RNA through transcription and then finally expressed as functioning proteins via translation. Thus, mutations of the DNA sequences of the plant alleles can have downstream effects on the expression of the plant’s pigment proteins, thereby changing its color.
f) Try making this protein: MLVKEIAMYRFATHER
CAGCTATAAATGTTAGTTAAAGAAATTGCTATGTATAGATTTGCTACTCATGAACGTGGGGGCGT GTCGATATTTACAATCAATTTCTTTAACGATACATATCTAAACGATGAGTACTTGCACCCCCGCA
Conclusion
- A DNA sequence that codes for a purple pigment protein in these plants was created and is listed above. Cross breeding of the initial plants created a purple colored flower. The purple pigment protein responsible for the coloration of this plant was isolated and its primary structure was sequenced. This amino acid sequence was used as the template for the generation of a DNA strand that expressed a purple pigment. The findings of this study verify the Central of Dogma of Biology by substantiating the relationship between DNA, mRNA, and proteins. By altering the DNA sequence of specific plant alleles, a different mRNA was transcribed and thus, a different protein expressed.
Acknowledgements
- Dr. Dahlquist; professor
- Jonar Cowen; homework partner
- Michael Armas; classmate
- Kaitlyn Nguyen; classmate
- Marcus Avila; classmate
- Ivy-Quynh Macaraeg; classmate
- John Nimmers-Minor; classmate
- Emma Young; classmate
- Mihir Samdarshi; classmate
Except for what is noted above, this individual journal entry was completed by me and not copied from another source.Ymesfin (talk) 19:48, 11 September 2019 (PDT)
References
Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/
