Difference between revisions of "Jnimmers Week 2 Individual Journal"
(Changed blue differences) |
(Added breaks between questions) |
||
| Line 1: | Line 1: | ||
[[Category:Journal Entry]] | [[Category:Journal Entry]] | ||
| − | a) What are the differences in the DNA sequences of the alleles you defined in Part I. | + | a) What are the differences in the DNA sequences of the alleles you defined in Part I.<br> |
| − | b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences. | + | |
| − | c) Which DNA sequences are found in each of the four starting organisms? | + | b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences. <br> |
| − | d) Using this knowledge, construct a pure-breeding purple organism. | + | |
| + | c) Which DNA sequences are found in each of the four starting organisms? <br> | ||
| + | |||
| + | d) Using this knowledge, construct a pure-breeding purple organism. <br> | ||
| + | |||
e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I? f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy) | e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I? f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy) | ||
Revision as of 18:40, 10 September 2019
a) What are the differences in the DNA sequences of the alleles you defined in Part I.
b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.
c) Which DNA sequences are found in each of the four starting organisms?
d) Using this knowledge, construct a pure-breeding purple organism.
e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I? f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)
White: 5'-CAGCTATGACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'
Red: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'
Yellow:
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'
Green 1: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3'
Blue: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3'