Difference between revisions of "Jnimmers Week 2 Individual Journal"
(Solved question d) |
(Answered letter e and b) |
||
| Line 4: | Line 4: | ||
b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences. <br> | b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences. <br> | ||
| − | + | *No, it is possible to create a white allele with a different DNA sequence than another white allele. As long as the white allele is absent of Tyrosine, Tryptophan, and Phenol, it will likely be white.<br_ | |
c) Which DNA sequences are found in each of the four starting organisms? <br> | c) Which DNA sequences are found in each of the four starting organisms? <br> | ||
| Line 10: | Line 10: | ||
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3' | 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3' | ||
| − | Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed). | + | *Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed). |
| + | |||
| + | e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I? <br> | ||
| + | *Aromatic ring structures Tyrosine, Tryptophan and Phenol are the amino acids that create the color for each of the alleles and the combinations of these ring structures allow for different phenotypic differences in the color of each differing flower. That being said, if one of these amino acids are changed, the color also changes, however, if the amino acid stays the same but the sequence changes (i.e. TTT and TTC both code for Phenol) then the color remains the same. | ||
| − | + | f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy) | |
White: | White: | ||
Revision as of 20:55, 10 September 2019
a) What are the differences in the DNA sequences of the alleles you defined in Part I.
b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.
- No, it is possible to create a white allele with a different DNA sequence than another white allele. As long as the white allele is absent of Tyrosine, Tryptophan, and Phenol, it will likely be white.<br_
c) Which DNA sequences are found in each of the four starting organisms?
d) Using this knowledge, construct a pure-breeding purple organism.
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3'
- Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed).
e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?
- Aromatic ring structures Tyrosine, Tryptophan and Phenol are the amino acids that create the color for each of the alleles and the combinations of these ring structures allow for different phenotypic differences in the color of each differing flower. That being said, if one of these amino acids are changed, the color also changes, however, if the amino acid stays the same but the sequence changes (i.e. TTT and TTC both code for Phenol) then the color remains the same.
f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)
White: 5'-CAGCTATGACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'
Red: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'
Yellow:
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'
Green 1: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3'
Blue: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3'
