Difference between revisions of "Jnimmers Week 2 Individual Journal"

From LMU BioDB 2019
Jump to navigation Jump to search
(fixed names)
Line 8: Line 8:
 
The methodology of each task of the assignment can be seen below:
 
The methodology of each task of the assignment can be seen below:
 
Task a)
 
Task a)
−
*I first began by downloading and becoming accustomed to the Aipotu software with assistance from [[User:kdalquist| Dr. Kam Dalquist]] and my homework partner [[User:Msamdars | Mihir Sandarshi]]
+
*I first began by downloading and becoming accustomed to the Aipotu software with assistance from [[User:Kdahlquist| Dr. Kam Dalquist]] and my homework partner [[User:Msamdars | Mihir Sandarshi]]
 
*Once accustomed, in order to obtain more pure breeding and hybrid alleles and corresponding phenotypes for the flowers being studied, each original color (Green-1, Green-2, Red, White, and Yellow) was cross and self breed, allowing for the finding of five new alleles (Blue, Black, Oramge, Purple and Yellow) using the Genetics tab
 
*Once accustomed, in order to obtain more pure breeding and hybrid alleles and corresponding phenotypes for the flowers being studied, each original color (Green-1, Green-2, Red, White, and Yellow) was cross and self breed, allowing for the finding of five new alleles (Blue, Black, Oramge, Purple and Yellow) using the Genetics tab
 
*With the new alleles discovered, Each pure-breeding allele had their DNA sequenece compared against the White allele (which was an arbitraty, recessive, and pure-breeding allele) to find where each DNA sequence differed.
 
*With the new alleles discovered, Each pure-breeding allele had their DNA sequenece compared against the White allele (which was an arbitraty, recessive, and pure-breeding allele) to find where each DNA sequence differed.

Revision as of 19:56, 11 September 2019


Purpose: The purpose of these investigations were to gain a better understanding of DNA sequence coding, amino acids and their effect on allele function, and refresh my knowledge of molecular biology, genetics, and biochemistry, with an emphasis on molecular biology. By using the program, Aipotu, we will be working with and learning computation skills in the field of Biology that may be of use in the future.

Methods: The methodology of each task of the assignment can be seen below: Task a)

  • I first began by downloading and becoming accustomed to the Aipotu software with assistance from Dr. Kam Dalquist and my homework partner Mihir Sandarshi
  • Once accustomed, in order to obtain more pure breeding and hybrid alleles and corresponding phenotypes for the flowers being studied, each original color (Green-1, Green-2, Red, White, and Yellow) was cross and self breed, allowing for the finding of five new alleles (Blue, Black, Oramge, Purple and Yellow) using the Genetics tab
  • With the new alleles discovered, Each pure-breeding allele had their DNA sequenece compared against the White allele (which was an arbitraty, recessive, and pure-breeding allele) to find where each DNA sequence differed.

Task b)

  • To find if there any differences between the White alleles' sequences, I added and removed random bases and amino acids too find if White was specific to it's original DNA sequence and I found that it can be produced with many different DNA sequences!

Task c)

  • Utilizing assistance from Mike Armas, I was able to decude that the primary factor that lead to the flowers having specific colors was the prescene or absence of certain amino acids in the sequence.
  • After obtaining this information, I began to search for which alleles cross to create the Purple allele, this was done back in the Genetics tab.
  • This process left me with the answer that Blue and Red must cross to produce a Purple allele, and the only difference between Red and Blue DNA sequences was that Red contained Phenylalanine and Blue contained Tryptophan.
  • By using the Molecular Biology tab once more, I inserted a Phenylalanine into a sequence corresponding the the Blue allele, and not only was a purple flower formed, but when cross-breed with itself, it produced a phenotypically Purple offspring, meaning it is pure-breeding.

a) What are the differences in the DNA sequences of the alleles you defined in Part I.

  • Using the White allele as a standard baseline, I was able to find how alleles differed from White. As seen below by the bold letters (representative of differences of differences in bases between the White allele and the other allele): Red differs from White at the 78th position, Yellow differs at positions 78, 79, and 80, Green differs at positions 78, 79, and 83, and Blue differs at positions 78 and 79.

See Table at the bottom

White (Baseline): 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3'

Red: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'

Yellow: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'
Green 1: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3'

Blue: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3'


b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.

  • No, it is possible to create a white allele with a different DNA sequence than another white allele. As long as the white allele is absent of Tyrosine, Tryptophan, and Phenylalanine, it will likely be white.<br_

c) Which DNA sequences are found in each of the four starting organisms?

  • All 4 starting organisms begin with the DNA sequence below and begin to differ once the reach position 77
  • 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG-3'

d) Using this knowledge, construct a pure-breeding purple organism.

  • 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3'
  • Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed).

e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?

  • Aromatic ring structures Tyrosine, Tryptophan and Phenylalanine are the amino acids that create the color for each of the alleles and the combinations of these ring structures allow for different phenotypic differences in the color of each differing flower. That being said, if one of these amino acids are changed, the color also changes, however, if the amino acid stays the same but the sequence changes (i.e. TTT and TTC both code for Phenylalanine) then the color remains the same.

f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)

  • 5'-ATGCTTGTCAAGGAGATCGCCATGTATAGGTTTGCAACGCACGAACGT-3'
  • MLVKEIAMYRFATHER- Met,Leu, Val, Lys, Glu, Ile, Ala, Met, Tyr, Arg, Phe, Ala, Thr, His, Glu, Arg


  • DNA bases that differ from the bases at the same poistion on in the White flower sequence are bolded
Allele Color Change(s) in Amino Acid Sequence Change(s) in DNA Sequence
W White (Baseline) 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValValCysArgGln-C
B Blue 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValTyrCysArgGln-C
G Green 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValTyrTrpArgGln-C
R Red 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValPheCysArgGln-C
Y Yellow 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValTrpCysArgGln-C