Difference between revisions of "Jnimmers Week 2 Individual Journal"

From LMU BioDB 2019
Jump to navigation Jump to search
(Added category)
(→‎Week 2 Individual Journal Assignment)
 
(55 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
{{jnimmers}}
+
 
 
[[Category:Journal Entry]]
 
[[Category:Journal Entry]]
 +
=Week 2 Individual Journal Assignment=
 +
==Electronic Lab Notebook==
 +
[[User:Jnimmers| John Nimmers-Minor]]
 +
===Purpose===
 +
The purpose of these investigations were to gain a better understanding of DNA sequence coding, amino acids and their effect on allele function, and refresh my knowledge of molecular biology, genetics, and biochemistry, with an emphasis on molecular biology. By using the program, Aipotu, we will be working with and learning computation skills in the field of Biology that may be of use in the future.
 +
 +
===Method===
 +
The methodology of each task of the assignment can be seen below:
 +
 +
====Task a)====
 +
*I first began by downloading and becoming accustomed to the Aipotu software with assistance from [[User:Kdahlquist| Dr. Kam Dalquist]] and my homework partner [[User:Msamdars | Mihir Sandarshi]]
 +
*Once accustomed, in order to obtain more pure breeding and hybrid alleles and corresponding phenotypes for the flowers being studied, each original color (Green-1, Green-2, Red, White, and Yellow) was cross and self breed, allowing for the finding of five new alleles (Blue, Black, Oramge, Purple and Yellow) using the Genetics tab (''See images on the right'') [[image:Before.PNG|thumb|Screenshot of Genetic tab before the cross breeding of species]][[image:After.PNG|thumb|Screenshot of Genetic tab after the cross breeding of species]]
 +
*With the new alleles discovered, Each pure-breeding allele had their DNA sequenece compared against the White allele (which was an arbitraty, recessive, and pure-breeding allele) to find where each DNA sequence differed.
 +
 +
====Task b)====
 +
*To find if there any differences between the White alleles' sequences, I added and removed random bases and amino acids too find if White was specific to it's original DNA sequence and I found that it can be produced with many different DNA sequences!
 +
 +
====Task c)====
 +
 +
*In observations of the comparison of all the alleles against the White allele baseline, it became understood that before position 78, all alleles were completely identical to the White allele's DNA sequence. At position 78 and on is where variation began, however, if all the alleles' DNA sequences were identical to the White allele sequence, it meant that every DNA sequence was identical up to position 77.
 +
 +
====Task d)====
 +
 +
*Utilizing assistance from [[User:Marmas | Mike Armas]], I was able to decude that the primary factor that lead to the flowers having specific colors was the prescene or absence of certain amino acids in the sequence.
 +
*After obtaining this information, I began to search for which alleles cross to create the Purple allele, this was done back in the Genetics tab.
 +
*This process left me with the answer that Blue and Red must cross to produce a Purple allele, and the only difference between Red and Blue DNA sequences was that Red contained Phenylalanine and Blue contained Tryptophan.
 +
*By using the Molecular Biology tab once more, I inserted a Phenylalanine into a sequence corresponding the the Blue allele, and not only was a purple flower formed, but when cross-breed with itself, it produced a phenotypically Purple offspring, meaning it is pure-breeding.
 +
 +
====Task e)====
 +
 +
*By using previously obtained knowledge about the relationship between amino acids and allele color, it was possible to draw my conclusion by comparing the structure of all three "color-inducing" amino acids.
 +
*One commonality between all three amino acids was that they were all Aromatic ring structures, and as said previously, the ring-structured amino acids were the factors that determined the color of the flower.
 +
 +
====Task f)====
 +
 +
*It was clear that the letters that made up the protein "LVKEIAMYRFATHER" corresponded to the abbreviation form of amino acids that could be created.
 +
*By using the Biochemistry tab to find the abbreviation names of all amino acids, it was possible to build the protein through the assembling of into amino acid components. ((''See lowest image to the right'')) [[image:Protein fold.PNG|thumb|Photo of final protein fold of MLVKEIAMYRFATHER]]
 +
 +
===Results===
 +
====Molecular Biology Specific Tasks====
 +
 +
''a) What are the differences in the DNA sequences of the alleles you defined in Part I.''<br>
 +
*Using the White allele as a standard baseline, I was able to find how alleles differed from White. As seen below by the bold letters (representative of differences of differences in bases between the White allele and the other allele): Red differs from White at the 78th position, Yellow differs at positions 78, 79, and 80, Green differs at positions 78, 79, and 83, and Blue differs at positions 78 and 79.
 +
 +
''Also see Table at the bottom''
 +
 +
White ''(Baseline)'':
 +
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3'
 +
 +
Red:
 +
5'-CAGCTAT'''A'''ACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'
 +
 +
Yellow:
 +
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''TGG'''TGTCGGCAGTAGTAGGGGGCGT-3'
 +
'''<br>
 +
Green 1:
 +
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''TA'''CTG'''G'''CGGCAGTAGTAGGGGGCGT-3'
 +
 +
Blue:
 +
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''TA'''CTGTCGGCAGTAGTAGGGGGCGT-3'
 +
 +
 +
b) ''Do all the white alleles have the same DNA sequence?  Hint: use the Compare menu to compare the sequences.'' <br>
 +
*No, it is possible to create a white allele with a different DNA sequence than another white allele. As long as the white allele is absent of Tyrosine, Tryptophan, and Phenylalanine, it will likely be white.<br_
 +
''c) Which DNA sequences are found in each of the four starting organisms? <br>''
 +
*All 4 starting organisms begin with the DNA sequence below and begin to differ once the reach position 77<br>
 +
*5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG-3'
 +
 +
''d) Using this knowledge, construct a pure-breeding purple organism. <br>''
 +
*5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3'
 +
 +
*Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed).
 +
 +
''e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I? <br>''
 +
*Aromatic ring structures Tyrosine, Tryptophan and Phenylalanine are the amino acids that create the color for each of the alleles and the combinations of these ring structures allow for different phenotypic differences in the color of each differing flower. That being said, if one of these amino acids are changed, the color also changes, however, if the amino acid stays the same but the sequence changes (i.e. TTT and TTC both code for Phenylalanine) then the color remains the same.
 +
 +
''f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)''
 +
*DNA Sequence: 5'-ATGCTTGTCAAGGAGATCGCCATGTATAGGTTTGCAACGCACGAACGT-3'
 +
 +
*Amino Acid Sequence: MLVKEIAMYRFATHER- Met,Leu, Val, Lys, Glu, Ile, Ala, Met, Tyr, Arg, Phe, Ala, Thr, His, Glu, Arg
 +
 +
====Allele and Sequence Table====
 +
*''DNA bases that differ from the bases at the same poistion on in the White flower sequence are bolded''
 +
{|
 +
!Allele
 +
!Color
 +
!Change(s) in Amino Acid Sequence
 +
!Change(s) in DNA Sequence
 +
|-
 +
|W
 +
|White ''(Baseline)''
 +
|5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3'
 +
|N-MetSerAsnArgHisIleLeuLeuValValCysArgGln-C
 +
|-
 +
|B
 +
|Blue
 +
|5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''TA'''CTGTCGGCAGTAGTAGGGGGCGT-3'
 +
|N-MetSerAsnArgHisIleLeuLeuVal'''Tyr'''CysArgGln-C
 +
|-
 +
|G
 +
|Green
 +
|5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''TA'''CTG'''G'''CGGCAGTAGTAGGGGGCGT-3'
 +
|N-MetSerAsnArgHisIleLeuLeuVal'''TyrTrp'''ArgGln-C
 +
|-
 +
|R
 +
|Red
 +
|5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''T'''TCTGTCGGCAGTAGTAGGGGGCGT-3'
 +
|N-MetSerAsnArgHisIleLeuLeuVal'''Phe'''CysArgGln-C
 +
|-
 +
|Y
 +
|Yellow
 +
|5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG'''TGG'''TGTCGGCAGTAGTAGGGGGCGT-3'
 +
|N-MetSerAsnArgHisIleLeuLeuVal'''Trp'''CysArgGln-C
 +
 +
|}
 +
 +
====Observation and Findings====
 +
 +
*Based on the findings obtained through the solving of the Molecular Biology specific tasks, it was found that the Aromatic ring-structured amino acids: Tyrosine, Tryptophan, and Phenylalanine were the primary factors in determining whether or not a flower would have a certain color. Additionally, any flower that did not contain at least one of those amino acids would be produced with the White allele, which lead me to the conclusion about the aromatic amino acids determining the flower's phenotype.
 +
* Through the Genetics tab, I found that certain color mixes lead to new, hybrid allele colors, these color hybridizations are as follows:
 +
**Green-2/Green-2 produces Blue as well as Yellow
 +
**Red/Yellow produces Orange
 +
**Blue/Green-1 or Green-2 produces Purple
 +
**Purple/Green-1 produces Black
 +
**Any allele crosses that involve White an a separate color will always produce offspring of the second color. Meaning that white is a recessive allele to all other alleles.
 +
*In order to create a phenotypically Purple allele, both Tyrosine and Phenylalanine must be present in the amino acid sequence.
 +
 +
===Conclusion===
 +
The utilization of the Apiotu software gave me a small glimpse into the work of a Molecular Biologist, and while it was incredibly difficult to complete the asks using only knowledge on Molecular Biology, the utilization of different databases such as Genetics and Biocheistry made the tasks much similar. The purpose of this project was to help connect Biology principles with introductory level Computer Science learning, and it certainly succeeded in it's goal. This project helped bridge the gap between different specialities of Biology as well as help strengthen the mental connection I have between Biology and Computer Science by allowing Biological questions to be answered through computational means.
 +
 +
===Data and Files===
 +
{|
 +
|[[File:Before.PNG|200px|thumb|Screenshot of Genetics tab before cross breeding]]
 +
|[[File:After.PNG|200px|thumb|Screenshot of Genetics tab after allele cross breeding]]
 +
|[[File:Protein fold.PNG|200px|thumb|Final protein fold of MLVKEIAMYRFATHER]]
 +
|}
 +
 +
If you are interested in trying this project out yourself, please visit [[http://aipotu.umb.edu/  Apiotu's Website]] to download the program
 +
 +
===Acknowledgements===
 +
* I would like to thank [[User:Kdahlquist| Dr. Kam Dahlquist]] for the introduction to the Apiotu program as well as information on how to operate it in order to complete the necessary tasks.
 +
* Thank you to my homework partner [[User:Msamdars| Mirhir Samdarshi]] for his assistance. We met in person and spoke over the phone in order to complete the Apiotu tasks and his Wiki syntax allowed for me to create my table that was utilized in this assignment
 +
*Thank you to [[User:Marmas| Mike Armas]] for his assistance in identifying the importance of the aromatic amino acids and their role in determining the color of each flower phenotype. Thank you to him for the assistance of my Wiki syntax in order to create a better, neater page layout.
 +
*Except for what is noted above, this journal entry was done by me and not copied from another source.
 +
 +
'''References'''
 +
*LMU BioDB 2019. (2019). Week 2. Retrieved September 11, 2019, from https://xmlpipedb.cs.lmu.edu/biodb/fall2019/index.php/Week_
 +
*White, Brian (2017, May 24). Aipotu. Retrieved September 11, 2019 from http://aipotu.umb.edu/

Latest revision as of 23:11, 11 September 2019

Week 2 Individual Journal Assignment

Electronic Lab Notebook

John Nimmers-Minor

Purpose

The purpose of these investigations were to gain a better understanding of DNA sequence coding, amino acids and their effect on allele function, and refresh my knowledge of molecular biology, genetics, and biochemistry, with an emphasis on molecular biology. By using the program, Aipotu, we will be working with and learning computation skills in the field of Biology that may be of use in the future.

Method

The methodology of each task of the assignment can be seen below:

Task a)

  • I first began by downloading and becoming accustomed to the Aipotu software with assistance from Dr. Kam Dalquist and my homework partner Mihir Sandarshi
  • Once accustomed, in order to obtain more pure breeding and hybrid alleles and corresponding phenotypes for the flowers being studied, each original color (Green-1, Green-2, Red, White, and Yellow) was cross and self breed, allowing for the finding of five new alleles (Blue, Black, Oramge, Purple and Yellow) using the Genetics tab (See images on the right)
    Screenshot of Genetic tab before the cross breeding of species
    Screenshot of Genetic tab after the cross breeding of species
  • With the new alleles discovered, Each pure-breeding allele had their DNA sequenece compared against the White allele (which was an arbitraty, recessive, and pure-breeding allele) to find where each DNA sequence differed.

Task b)

  • To find if there any differences between the White alleles' sequences, I added and removed random bases and amino acids too find if White was specific to it's original DNA sequence and I found that it can be produced with many different DNA sequences!

Task c)

  • In observations of the comparison of all the alleles against the White allele baseline, it became understood that before position 78, all alleles were completely identical to the White allele's DNA sequence. At position 78 and on is where variation began, however, if all the alleles' DNA sequences were identical to the White allele sequence, it meant that every DNA sequence was identical up to position 77.

Task d)

  • Utilizing assistance from Mike Armas, I was able to decude that the primary factor that lead to the flowers having specific colors was the prescene or absence of certain amino acids in the sequence.
  • After obtaining this information, I began to search for which alleles cross to create the Purple allele, this was done back in the Genetics tab.
  • This process left me with the answer that Blue and Red must cross to produce a Purple allele, and the only difference between Red and Blue DNA sequences was that Red contained Phenylalanine and Blue contained Tryptophan.
  • By using the Molecular Biology tab once more, I inserted a Phenylalanine into a sequence corresponding the the Blue allele, and not only was a purple flower formed, but when cross-breed with itself, it produced a phenotypically Purple offspring, meaning it is pure-breeding.

Task e)

  • By using previously obtained knowledge about the relationship between amino acids and allele color, it was possible to draw my conclusion by comparing the structure of all three "color-inducing" amino acids.
  • One commonality between all three amino acids was that they were all Aromatic ring structures, and as said previously, the ring-structured amino acids were the factors that determined the color of the flower.

Task f)

  • It was clear that the letters that made up the protein "LVKEIAMYRFATHER" corresponded to the abbreviation form of amino acids that could be created.
  • By using the Biochemistry tab to find the abbreviation names of all amino acids, it was possible to build the protein through the assembling of into amino acid components. ((See lowest image to the right))
    Photo of final protein fold of MLVKEIAMYRFATHER

Results

Molecular Biology Specific Tasks

a) What are the differences in the DNA sequences of the alleles you defined in Part I.

  • Using the White allele as a standard baseline, I was able to find how alleles differed from White. As seen below by the bold letters (representative of differences of differences in bases between the White allele and the other allele): Red differs from White at the 78th position, Yellow differs at positions 78, 79, and 80, Green differs at positions 78, 79, and 83, and Blue differs at positions 78 and 79.

Also see Table at the bottom

White (Baseline): 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3'

Red: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'

Yellow: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'
Green 1: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3'

Blue: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3'


b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.

  • No, it is possible to create a white allele with a different DNA sequence than another white allele. As long as the white allele is absent of Tyrosine, Tryptophan, and Phenylalanine, it will likely be white.<br_

c) Which DNA sequences are found in each of the four starting organisms?

  • All 4 starting organisms begin with the DNA sequence below and begin to differ once the reach position 77
  • 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG-3'

d) Using this knowledge, construct a pure-breeding purple organism.

  • 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3'
  • Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed).

e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?

  • Aromatic ring structures Tyrosine, Tryptophan and Phenylalanine are the amino acids that create the color for each of the alleles and the combinations of these ring structures allow for different phenotypic differences in the color of each differing flower. That being said, if one of these amino acids are changed, the color also changes, however, if the amino acid stays the same but the sequence changes (i.e. TTT and TTC both code for Phenylalanine) then the color remains the same.

f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)

  • DNA Sequence: 5'-ATGCTTGTCAAGGAGATCGCCATGTATAGGTTTGCAACGCACGAACGT-3'
  • Amino Acid Sequence: MLVKEIAMYRFATHER- Met,Leu, Val, Lys, Glu, Ile, Ala, Met, Tyr, Arg, Phe, Ala, Thr, His, Glu, Arg

Allele and Sequence Table

  • DNA bases that differ from the bases at the same poistion on in the White flower sequence are bolded
Allele Color Change(s) in Amino Acid Sequence Change(s) in DNA Sequence
W White (Baseline) 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValValCysArgGln-C
B Blue 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValTyrCysArgGln-C
G Green 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValTyrTrpArgGln-C
R Red 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValPheCysArgGln-C
Y Yellow 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3' N-MetSerAsnArgHisIleLeuLeuValTrpCysArgGln-C

Observation and Findings

  • Based on the findings obtained through the solving of the Molecular Biology specific tasks, it was found that the Aromatic ring-structured amino acids: Tyrosine, Tryptophan, and Phenylalanine were the primary factors in determining whether or not a flower would have a certain color. Additionally, any flower that did not contain at least one of those amino acids would be produced with the White allele, which lead me to the conclusion about the aromatic amino acids determining the flower's phenotype.
  • Through the Genetics tab, I found that certain color mixes lead to new, hybrid allele colors, these color hybridizations are as follows:
    • Green-2/Green-2 produces Blue as well as Yellow
    • Red/Yellow produces Orange
    • Blue/Green-1 or Green-2 produces Purple
    • Purple/Green-1 produces Black
    • Any allele crosses that involve White an a separate color will always produce offspring of the second color. Meaning that white is a recessive allele to all other alleles.
  • In order to create a phenotypically Purple allele, both Tyrosine and Phenylalanine must be present in the amino acid sequence.

Conclusion

The utilization of the Apiotu software gave me a small glimpse into the work of a Molecular Biologist, and while it was incredibly difficult to complete the asks using only knowledge on Molecular Biology, the utilization of different databases such as Genetics and Biocheistry made the tasks much similar. The purpose of this project was to help connect Biology principles with introductory level Computer Science learning, and it certainly succeeded in it's goal. This project helped bridge the gap between different specialities of Biology as well as help strengthen the mental connection I have between Biology and Computer Science by allowing Biological questions to be answered through computational means.

Data and Files

Screenshot of Genetics tab before cross breeding
Screenshot of Genetics tab after allele cross breeding
Final protein fold of MLVKEIAMYRFATHER

If you are interested in trying this project out yourself, please visit [Apiotu's Website] to download the program

Acknowledgements

  • I would like to thank Dr. Kam Dahlquist for the introduction to the Apiotu program as well as information on how to operate it in order to complete the necessary tasks.
  • Thank you to my homework partner Mirhir Samdarshi for his assistance. We met in person and spoke over the phone in order to complete the Apiotu tasks and his Wiki syntax allowed for me to create my table that was utilized in this assignment
  • Thank you to Mike Armas for his assistance in identifying the importance of the aromatic amino acids and their role in determining the color of each flower phenotype. Thank you to him for the assistance of my Wiki syntax in order to create a better, neater page layout.
  • Except for what is noted above, this journal entry was done by me and not copied from another source.

References