Difference between revisions of "RAD53 / YPL153C Week 3"
(Added syntax from wrong named page. The previous page did not have our gene name) |
(→adding numbers) |
||
| Line 9: | Line 9: | ||
The summary should be one paragraph about the function of your gene based on what you have read in each of the four databases. This is one paragraph that synthesizes information, not one paragraph per database. | The summary should be one paragraph about the function of your gene based on what you have read in each of the four databases. This is one paragraph that synthesizes information, not one paragraph per database. | ||
| − | ===Standard name, systematic name, and name description for your gene (from SGD)?=== | + | ===1. Standard name, systematic name, and name description for your gene (from SGD)?=== |
Standard Name: Rad53 | Standard Name: Rad53 | ||
| Line 19: | Line 19: | ||
It is a DNA damage response kinase and plays a role in the initiation of DNA replication | It is a DNA damage response kinase and plays a role in the initiation of DNA replication | ||
| − | ===Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?=== | + | ===2. Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?=== |
Gene ID in SGD: S000006074 | Gene ID in SGD: S000006074 | ||
| Line 31: | Line 31: | ||
All 4 databases use the same Gene ID | All 4 databases use the same Gene ID | ||
| − | ===DNA sequence of your gene?=== | + | ===3. DNA sequence of your gene?=== |
ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT | ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT | ||
GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG | GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG | ||
| Line 75: | Line 75: | ||
TCGTAA | TCGTAA | ||
| − | ===Protein sequence corresponding to your gene?=== | + | ===4. Protein sequence corresponding to your gene?=== |
[[File:Tesfaiohannes DNA translation.png|500px|thumb|middle| Translation of the DNA sequence RAD53]] | [[File:Tesfaiohannes DNA translation.png|500px|thumb|middle| Translation of the DNA sequence RAD53]] | ||
| Line 82: | Line 82: | ||
https://web.expasy.org/translate/ | https://web.expasy.org/translate/ | ||
| − | ===Function of your gene?=== | + | ===5. Function of your gene?=== |
RAD53 encodes for a protein kinase which is required for the cell cycle checkpoint. It amplifies the initial signals for proteins that recognize DNA damage. A loss in RAD53 can lead to defects in checkpoint activation. | RAD53 encodes for a protein kinase which is required for the cell cycle checkpoint. It amplifies the initial signals for proteins that recognize DNA damage. A loss in RAD53 can lead to defects in checkpoint activation. | ||
| − | ===What was different about the information provided about your gene in each of the parent databases?=== | + | ===6. What was different about the information provided about your gene in each of the parent databases?=== |
===Were there differences in content, the information or data itself?=== | ===Were there differences in content, the information or data itself?=== | ||
| Line 92: | Line 92: | ||
===Were there differences in presentation of the information?=== | ===Were there differences in presentation of the information?=== | ||
| − | ===Why did you choose your particular gene? i.e., why is it interesting to you and your partner?=== | + | ===7. Why did you choose your particular gene? i.e., why is it interesting to you and your partner?=== |
| − | Include an image related to your gene (be careful that you do not violate any copyright restrictions!) | + | ===8. Include an image related to your gene (be careful that you do not violate any copyright restrictions!)=== |
Please make the image something scientific (not like the random images seen on the SGD blog posts). | Please make the image something scientific (not like the random images seen on the SGD blog posts). | ||
If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too. | If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too. | ||
Revision as of 15:18, 17 September 2019
Contents
- 1 My Favorite Gene
- 1.1 Summary of RAD53/ YPL153C:
- 1.2 1. Standard name, systematic name, and name description for your gene (from SGD)?
- 1.3 2. Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?
- 1.4 3. DNA sequence of your gene?
- 1.5 4. Protein sequence corresponding to your gene?
- 1.6 5. Function of your gene?
- 1.7 6. What was different about the information provided about your gene in each of the parent databases?
- 1.8 Were there differences in content, the information or data itself?
- 1.9 Were there differences in presentation of the information?
- 1.10 7. Why did you choose your particular gene? i.e., why is it interesting to you and your partner?
- 1.11 8. Include an image related to your gene (be careful that you do not violate any copyright restrictions!)
- 1.12 Acknowledgments
- 1.13 References
My Favorite Gene
Christina Dominguez and Naomi Tesfaiohannes
Summary of RAD53/ YPL153C:
RAD53 is a DNA damage response. It is required for cell cycle arrest. Its signal transduction pathway component is required for DNA damage and replication.
The summary should be one paragraph about the function of your gene based on what you have read in each of the four databases. This is one paragraph that synthesizes information, not one paragraph per database.
1. Standard name, systematic name, and name description for your gene (from SGD)?
Standard Name: Rad53
Systematic Name: YPL153C
Name Description: RADiation sensitive
It is a DNA damage response kinase and plays a role in the initiation of DNA replication
2. Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?
Gene ID in SGD: S000006074
Gene ID in NCBI: S000006074
Gene ID in Ensembl: S000006074
Gene ID in UniProt: S000006074
All 4 databases use the same Gene ID
3. DNA sequence of your gene?
ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG GGTCAAATTCCCATCCGAGATTTGTCAGCTGATATTTCACAAGTGCTTAAGGAAAAACGA TCCATAAAGAAAGTTTGGACATTTGGTAGAAACCCAGCCTGTGACTATCATTTAGGAAAC ATTTCAAGACTGTCAAATAAGCATTTCCAAATACTACTAGGAGAAGACGGTAACCTTTTA TTGAATGACATTTCCACTAATGGGACCTGGTTAAATGGGCAAAAAGTCGAGAAGAACAGC AATCAGTTACTGTCTCAAGGTGATGAAATAACCGTTGGTGTAGGCGTGGAATCAGATATT TTATCTCTGGTCATTTTCATAAACGACAAATTTAAGCAGTGCCTCGAGCAGAACAAAGTT GATCGCATAAGATCTAACCTGAAAAATACCTCTAAAATAGCTTCTCCTGGTCTTACATCA TCTACTGCATCATCAATGGTGGCCAACAAGACTGGTATTTTTAAGGATTTTTCGATTATT GACGAAGTGGTGGGCCAGGGTGCATTTGCCACAGTAAAGAAAGCCATTGAAAGAACTACT GGGAAAACATTCGCGGTGAAGATTATAAGTAAACGCAAAGTAATAGGCAATATGGATGGT GTGACAAGAGAGTTAGAAGTATTGCAAAAGCTCAATCATCCAAGGATAGTACGATTGAAA GGATTTTATGAAGATACTGAGAGTTATTATATGGTGATGGAGTTCGTTTCTGGTGGTGAC TTAATGGATTTTGTTGCTGCTCATGGTGCGGTTGGAGAAGATGCTGGGAGGGAGATATCC AGGCAGATACTCACAGCAATAAAATACATTCACTCTATGGGCATCAGCCATCGTGACCTA AAGCCCGATAATATTCTTATTGAACAAGACGATCCTGTATTGGTAAAGATAACCGACTTT GGTCTGGCAAAAGTACAAGGAAATGGGTCTTTTATGAAAACCTTCTGTGGCACTTTGGCA TATGTGGCACCTGAAGTCATCAGAGGTAAAGATACATCCGTATCTCCTGATGAATACGAA GAAAGGAATGAGTACTCTTCGTTAGTGGATATGTGGTCAATGGGATGTCTTGTGTATGTT ATCCTAACGGGCCACTTACCTTTTAGTGGTAGCACACAGGACCAATTATATAAACAGATT GGAAGAGGCTCATATCATGAAGGGCCCCTCAAAGATTTCCGGATATCTGAAGAAGCAAGA GATTTCATAGATTCATTGTTACAGGTGGATCCAAATAATAGGTCGACAGCTGCAAAAGCC TTGAATCATCCCTGGATCAAGATGAGTCCATTGGGCTCACAATCATATGGTGATTTTTCA CAAATATCCTTATCACAATCGTTGTCGCAGCAGAAATTATTAGAAAATATGGACGATGCT CAATACGAATTTGTCAAAGCGCAAAGGAAATTACAAATGGAGCAACAACTTCAAGAACAG GATCAGGAAGACCAAGATGGAAAAATTCAAGGATTTAAAATACCCGCACACGCCCCTATT CGATATACACAGCCCAAAAGCATTGAAGCAGAAACTAGAGAACAAAAACTTTTACATTCC AATAATACTGAGAATGTCAAGAGCTCAAAGAAAAAGGGTAATGGTAGGTTTTTAACTTTA AAACCATTGCCTGACAGCATTATTCAAGAAAGCCTGGAGATTCAGCAAGGTGTGAATCCA TTTTTCATTGGTAGATCCGAGGATTGCAATTGTAAAATTGAAGACAATAGGTTGTCTCGA GTTCATTGCTTCATTTTCAAAAAGAGGCATGCTGTAGGCAAAAGCATGTATGAATCTCCG GCACAAGGTTTAGATGATATTTGGTATTGCCACACCGGAACTAACGTGAGCTATTTAAAT AATAACCGCATGATACAGGGTACGAAATTCCTTTTACAAGACGGAGATGAAATCAAGATC ATTTGGGATAAAAACAATAAATTTGTCATTGGCTTTAAAGTGGAAATTAACGATACTACA GGTCTGTTTAACGAGGGATTAGGTATGTTACAAGAACAAAGAGTAGTACTTAAGCAAACA GCCGAAGAAAAAGATTTGGTGAAAAAGTTAACCCAGATGATGGCAGCTCAACGTGCAAAT CAACCCTCGGCTTCTTCTTCATCAATGTCGGCTAAGAAGCCGCCAGTTAGCGATACAAAT AATAACGGCAATAATTCGGTACTAAACGACTTGGTAGAGTCACCGATTAATGCGAATACG GGGAACATTTTGAAGAGAATACATTCGGTAAGTTTATCGCAATCACAAATTGATCCTAGT AAGAAGGTTAAAAGGGCAAAATTGGACCAAACCTCAAAAGGCCCCGAGAATTTGCAATTT TCGTAA
4. Protein sequence corresponding to your gene?
Frame 1 5'3' encodes the entire protein sequence
https://web.expasy.org/translate/
5. Function of your gene?
RAD53 encodes for a protein kinase which is required for the cell cycle checkpoint. It amplifies the initial signals for proteins that recognize DNA damage. A loss in RAD53 can lead to defects in checkpoint activation.
6. What was different about the information provided about your gene in each of the parent databases?
Were there differences in content, the information or data itself?
Were there differences in presentation of the information?
7. Why did you choose your particular gene? i.e., why is it interesting to you and your partner?
Please make the image something scientific (not like the random images seen on the SGD blog posts). If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too.
Acknowledgments
Both partners should sign the Academic Honesty statement with their wiki signatures. You need to cite the specific database page from which you derived your information for each of the questions. When answering the free-form questions, be sure to paraphrase.
"Except for what is noted above, this individual journal entry was completed by me and not copied from another source."
Ntesfaio (talk) 16:34, 16 September 2019 (PDT)
