Difference between revisions of "Jcowan4 Journal Week 2"
Jump to navigation
Jump to search
(First edit and answering of week 2 homework) |
(→References: invoke template) |
||
| (4 intermediate revisions by the same user not shown) | |||
| Line 11: | Line 11: | ||
What did you actually do? Give a step by step account. | What did you actually do? Give a step by step account. | ||
#Using the information fromo gentics and part 1 we cross bred plants to find the purple protein | #Using the information fromo gentics and part 1 we cross bred plants to find the purple protein | ||
| − | + | #Repeated process to find all combination for the purple protein (one combination only) | |
| − | + | #After finding the purple protein my homework partner and I compared the DNA sequence of different plants | |
| − | + | #After the comparing the DNA sequence we proceeded to compare amino acid chains | |
| − | + | #We then located the amino acids that create the purple pigmentation | |
| − | + | #We then altered the amino acid sequence to make a pure purple protein/flower | |
| − | ==Your Results== | + | ==Your Results== |
| + | |||
| + | *a) What are the differences in the DNA sequences of the alleles you defined in Part I. | ||
| + | :Blue and Yellow- DNA sequence: #79 (A for G), #80 (C for G) | ||
| + | :Red and White- DNA sequence: #79 (A for G) | ||
| + | :Red and Blue- DNA sequence: #79 (T for A) | ||
| + | :Red and Yellow- DNA sequence: #79 (T for G), #80 (C for G) | ||
| + | :Green and Red- DNA sequence: #79 (A for T), #80 (G for T) | ||
| + | |||
| + | *b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences. | ||
| + | :Yes because white alleles are all the same due to the recessive gene. All white DNA sequences are the same | ||
| + | |||
| + | *c) Which DNA sequences are found in each of the four starting organisms? | ||
| + | :Green-1:AGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACCGCCGTCATCATCCCCCGCA | ||
| + | :Green-2: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACAGCCGTCATCATCCCCCGCA | ||
| + | :Red: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACAAGACAGCCGTCATCATCCCCCGCA | ||
| + | :White: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACCAGACAGCCGTCATCATCCCCCGCA | ||
| + | *d) Using this knowledge, construct a pure-breeding purple organism. | ||
| + | :The protein sequence we found with help from the biochemistry group is AMINO SEQUENCE: Met Ser Asn Arg His Ile Leu Leu Val Val Tyr Phe Cys Arg Gln | ||
| + | *e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I? | ||
| + | :DNA sequence of different alleles are mistakes in the trancription process that cause different amino acids to be made. The change of the amino acid changes the the sequence causing a new expression to be formed. | ||
| + | *f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy) | ||
==A Scientific Conclusion== | ==A Scientific Conclusion== | ||
What was your main finding for today's project? Did you fulfill the purpose? Why or why not? | What was your main finding for today's project? Did you fulfill the purpose? Why or why not? | ||
| + | *The main finding was how to figure out how to affect DNA sequence and amino acid sequence in order to create a new breed type of plant. Also, to understand how to locate and figure out what each sequence does and how it represents the object. We fulfilled our purpose because we figured out how to locate and create a new breed of purple flowers. | ||
==Acknowledgements== | ==Acknowledgements== | ||
| Line 31: | Line 53: | ||
Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/ | Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/ | ||
| − | + | {{jcowan4}} | |
| − | |||
| − | |||
| − | |||
| − | |||
Latest revision as of 09:11, 16 September 2019
Contents
The Purpose
What was the purpose of your investigations?
- The purpose was to:
- Determine differences in DNA sequence of alleles
- Determine how DNA sequence of pigment protein genes determines color of the protein produced
- Figure out how the results of how alleles interact
- Construct a purple proptein
Your Methods
What did you actually do? Give a step by step account.
- Using the information fromo gentics and part 1 we cross bred plants to find the purple protein
- Repeated process to find all combination for the purple protein (one combination only)
- After finding the purple protein my homework partner and I compared the DNA sequence of different plants
- After the comparing the DNA sequence we proceeded to compare amino acid chains
- We then located the amino acids that create the purple pigmentation
- We then altered the amino acid sequence to make a pure purple protein/flower
Your Results
- a) What are the differences in the DNA sequences of the alleles you defined in Part I.
- Blue and Yellow- DNA sequence: #79 (A for G), #80 (C for G)
- Red and White- DNA sequence: #79 (A for G)
- Red and Blue- DNA sequence: #79 (T for A)
- Red and Yellow- DNA sequence: #79 (T for G), #80 (C for G)
- Green and Red- DNA sequence: #79 (A for T), #80 (G for T)
- b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.
- Yes because white alleles are all the same due to the recessive gene. All white DNA sequences are the same
- c) Which DNA sequences are found in each of the four starting organisms?
- Green-1:AGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACCGCCGTCATCATCCCCCGCA
- Green-2: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACAGCCGTCATCATCCCCCGCA
- Red: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACAAGACAGCCGTCATCATCCCCCGCA
- White: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGTGTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACCAGACAGCCGTCATCATCCCCCGCA
- d) Using this knowledge, construct a pure-breeding purple organism.
- The protein sequence we found with help from the biochemistry group is AMINO SEQUENCE: Met Ser Asn Arg His Ile Leu Leu Val Val Tyr Phe Cys Arg Gln
- e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?
- DNA sequence of different alleles are mistakes in the trancription process that cause different amino acids to be made. The change of the amino acid changes the the sequence causing a new expression to be formed.
- f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)
A Scientific Conclusion
What was your main finding for today's project? Did you fulfill the purpose? Why or why not?
- The main finding was how to figure out how to affect DNA sequence and amino acid sequence in order to create a new breed type of plant. Also, to understand how to locate and figure out what each sequence does and how it represents the object. We fulfilled our purpose because we figured out how to locate and create a new breed of purple flowers.
Acknowledgements
- Dr. Dahlquist
- Yeabsira Mesfin
"Except for what is noted above, this individual journal entry was completed by me and not copied from another source."
References
Aipotu. (2017, May 24). Retrieved on September 11, 2019 from http://aipotu.umb.edu/