Difference between revisions of "Week 2 Individual Journal"

From LMU BioDB 2019
Jump to navigation Jump to search
(added link to wk2 assignment)
(added conclusion)
Line 67: Line 67:
  
 
==Conclusion==
 
==Conclusion==
−
 
+
*A DNA sequence that codes for a purple pigment protein in these plants was created and is listed above. Cross breeding of the initial plants created a purple colored flower. The purple pigment protein responsible for the coloration of this plant was isolated and its primary structure was sequenced. This amino acid sequence was used as the template for the generation of a DNA strand that expressed a purple pigment. The findings of this study verify the Central of Dogma of Biology by substantiating the relationship between DNA, mRNA, and proteins. By altering the DNA sequence of specific plant alleles, a different mRNA was transcribed and thus, a different protein expressed.
−
 
 
 
[[User: ymesfin| Yeabsira Mesfin]]
 
[[User: ymesfin| Yeabsira Mesfin]]
  
 
[[Week 2| Week 2 Assignment]]
 
[[Week 2| Week 2 Assignment]]

Revision as of 17:36, 11 September 2019

Purpose

  • Differentiate the DNA sequence of different plant alleles
  • Determine the relationship between the DNA sequence of plant alleles and the expression of their pigment proteins
  • Determine how these plant alleles interact with one another
  • Create an allele that expresses a purple protein

Materials and Methods

Results

a) What are the differences in the DNA sequences of the alleles you defined in Part I.

  • allele color: Blue vs yellow
    • change(s) in amino acid sequence: Tyr for Trp
    • change(s) in DNA sequence: 79 (A for G), 80 (C for G)
  • allele color: Red vs White
    • change(s) in amino acid sequence: no mRNA for white allele
    • change(s) in DNA sequence: 9 (A for G)
  • allele color: Red vs Blue
    • change(s) in amino acid sequence: Phe for Try
    • change(s) in DNA sequence: 79 (T for A)
  • allele color: Red vs Yellow
    • change(s) in amino acid sequence: Phe for Trp
    • change(s) in DNA sequence: 79 (T for G), 80 (C for G)
  • allele color: Green vs Red
    • change(s) in amino acid sequence: Trp for Cys, Tyr for Phe
    • change(s) in DNA sequence: 79 (A for T), 83 (G for T)

b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.

Yes, they have the same sequence because they are the same allele

c) Which DNA sequences are found in each of the four starting organisms?

  • White
 CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT
 GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACCAGACAGCCGTCATCATCCCCCGCA
  • Red
 CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT
 GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACAAGACAGCCGTCATCATCCCCCGCA
  • Green 1
 AGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT
 GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACCGCCGTCATCATCCCCCGCA
  • Green 2
 CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT
 GTCGATATTGGCTCTAACTACAGATCACGCTATTCGGGGTTTCTAGCCGTGTAAAACACGCGATATGTTTCCAATCACATGACAGCCGTCATCATCCCCCGCA

d) Using this knowledge, construct a pure-breeding purple organism.

Protein Sequence: Met Ser Asn Arg His Ile Leu Leu Val Val Tyr Phe Cys Arg Gln

Allele 1:

 CAGCTATAA  ATGTCTAACAGACATATTCTCCTCGTCGTCTATTTTTGTCGTCAT GGGGGCGT
 GTCGATATT  TACAGATTGTCTGTATAAGAGGAGCAGCAGATAAAAACAGCAGTA CCCCCGCA

Allele 2:

 CAGCTATAA  ATGTCTAACAGACATATTCTCCTCGTCGTCTATTTTTGTCGTCAT GGGGGCGT
 GTCGATATT  TACAGATTGTCTGTATAAGAGGAGCAGCAGATAAAAACAGCAGTA CCCCCGCA

e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?

  • According to the Central Dogma of Biology, genetic information is carried from DNA to RNA through transcription and then finally expressed as functioning proteins via translation. Thus, mutations of the DNA sequences of the plant alleles can have downstream effects on the expression of the plant’s pigment proteins, thereby changing its color.

f) Try making this protein: MLVKEIAMYRFATHER

 CAGCTATAAATGTTAGTTAAAGAAATTGCTATGTATAGATTTGCTACTCATGAACGTGGGGGCGT
 GTCGATATTTACAATCAATTTCTTTAACGATACATATCTAAACGATGAGTACTTGCACCCCCGCA

Conclusion

  • A DNA sequence that codes for a purple pigment protein in these plants was created and is listed above. Cross breeding of the initial plants created a purple colored flower. The purple pigment protein responsible for the coloration of this plant was isolated and its primary structure was sequenced. This amino acid sequence was used as the template for the generation of a DNA strand that expressed a purple pigment. The findings of this study verify the Central of Dogma of Biology by substantiating the relationship between DNA, mRNA, and proteins. By altering the DNA sequence of specific plant alleles, a different mRNA was transcribed and thus, a different protein expressed.

Yeabsira Mesfin

Week 2 Assignment