ILT1/YDR090C Week 3

From LMU BioDB 2019
Revision as of 14:48, 17 September 2019 by Icrespin (talk | contribs) (→‎Images: added instructions)
Jump to navigation Jump to search

"Our Favorite Gene": ILT1/YDR090C

Gene ILT1 / YDR090C, part of the Saccharomyces Cerevisiae family, is an integral membrane protein (IMP) located on Chromosome IV on the reverse strand that has an unknown molecular function and biological process. It has a molecular weight of 34626.8 Da and an amino acid length of 310. It's primary transcript is YDR090C_mRNA, although much like it's function, information on this gene is unknown/assumed.

Additional Information

What is the standard name, systematic name, and name description for your gene (from SGD)?

  • Standard name: ILT1
  • Systematic name: YDR090C
  • Name description for gene: Ionic Liquid Tolerance

What is the gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)? Provide hyperlinks to the specific pages for your gene in each of the above databases.

  • Gene ID:
    • SGD - SGD:S000002497 - For more information, visit Saccharomyces Genome Database
    • NCBI - Gene ID: 851664 - For more information, visit NCBI
    • Ensembl - YDR090C - For more information, visit Ensembl
    • Uniprot - Q03193 (YD090_YEAST) - For more information, visit UniProtKB

What is the DNA sequence of your gene?

  • ATGATCTCTGAAAAGGCTGCTACCGCTTTAGCTACTATAGCAACAGTTTGCTGGTGTGTCCAGCTAATTCCGCAAAT
AATATATAATTGGAAAAAAAAGGACTGTACGGGGCTGCCACCACTGATGATGTTCCTCTGGGTTGTTTCCGGAATTCCAT
TTGCCATATATTTCTGTGTTAGTAAAGGTAATGTCATTTTACAAGTTCAACCACACCTTTTTATGTTCTTCTGTTCTATA
AGTTTCGTCCAATCGTGTTATTATCCACCAATCAGTATGGCGAGATCCAAAATAGTAATGATTGTAGCTGCTATTATTGC
GGCTGATGTTGGCATGGAAGTTGGCTTTATATTATGGCTGAGGCCCCTTTACGAGAAGGGTGTTAAATGGCCCGATCTGA
TTTTTGGTATTTCTGCATCTGTTTTGTTAGCTGTCGGACTGCTTCCACCTTACTTTGAACTAGCCAAAAGGAAAGGTCGT
GTTATTGGCATCAACTTTGCCTTCTTATTCATCGATTCATTAGGTGCTTGGCTATCTATCATCAGTGTTATCCTAGGTAA
TATGGATATTATGGGTATTATATTATACTCAATAGTTGCTGGAATGGAGTTAGGAATTTTCGCGTCTCATTTCATATGGT
GGTGTAGGTTTAGATTCCTAGCTAAAGGCAATACTTTTGACGAAGAAAGTGGCCAAGCTCAAAAGGAAGAACCCGATGAA
AAAATCGAACAAGATATTAGCAAGAGTGACCGAAATGTTACTAACTATAACCTGGATAACTGTTCAATCCCCGACGATGC
TTCGAGCTTTGCAGACGATTTTAATATATACGATAGTACTGATGGGGGGACGTTATCAAGAGCCCAAACATTGCATGCTG
TCCATGGAGTTGTGGTTAGAACAGATCCTGATCGTTATTCGAGGCTAAGTGTGTAA

What is the protein sequence corresponding to your gene?

  • Frame 1, located in the image, is the protein sequence that corresponds to the gene.

What is the function of your gene?

  • The function of this gene is unknown. Information on this gene is putative.

What was different about the information provided about your gene in each of the parent databases? Were there differences in content, the information or data itself? Were there differences in presentation of the information? Why did you choose your particular gene? i.e., why is it interesting to you and your partner?

  • This particular gene was chosen because much of its information has yet to be discovered. It is a protein with unknown function and very few research has been conducted and found on this gene. This sparked interest to us because it highlighted the very point of science and why we are biology majors: to discover (using research and evidence) to further identify and/or understand a distinct mechanism, organism, and/or gene.

Images

Include an image related to your gene (be careful that you do not violate any copyright restrictions!)

  • Take a screenshot of your results, display it on your wiki page, and state which frame it is.
  • Please make the image something scientific (not like the random images seen on the SGD blog posts).
  • If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too.
Results containing protein sequence for YDR090C. Translated from ExPASy.
This diagram displays phenotype observables (purple squares) that are shared between the given gene (yellow circle) and other genes (gray circles) based on the number of phenotype observables shared (adjustable using the slider at the bottom).

Acknowledgements

  • This section is in acknowledgement to partners, Kaitlyn Nguyen User:Knguye66 and Iliana Crespin User:Icrespin.
  • Kaitlyn did a lot of work in this wiki page from organizing to summarizing the gene. Iliana helped with organization and researching what this gene is about.
  • "Except for what is noted above, this individual journal entry was completed by me and not copied from another source." Icrespin (talk) 15:32, 17 September 2019 (PDT) Knguye66 (talk) 15:47, 17 September 2019 (PDT)

References

Wikipedia Techniques:

Retrieved from "https://xmlpipedb.lmucs.io/biodb/fall2019/index.php?title=ILT1/YDR090C_Week_3&oldid=2306"