Jnimmers Week 2 Individual Journal
a) What are the differences in the DNA sequences of the alleles you defined in Part I.
- Using the White allele as a standard baseline, I was able to find how alleles differed from White. As seen below by the bold letters (representative of differences of differences in bases between the White allele and the other allele): Red differs from White at the 78th position, Yellow differs at positions 78, 79, and 80, Green differs at positions 78, 79, and 83, and Blue differs at positions 78 and 79.
White: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT-3'
Red: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT-3'
Yellow:
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT-3'
Green 1:
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT-3'
Blue: 5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT-3'
b) Do all the white alleles have the same DNA sequence? Hint: use the Compare menu to compare the sequences.
- No, it is possible to create a white allele with a different DNA sequence than another white allele. As long as the white allele is absent of Tyrosine, Tryptophan, and Phenol, it will likely be white.<br_
c) Which DNA sequences are found in each of the four starting organisms?
- All 4 starting organisms begin with the DNA sequence below and begin to differ once the reach position 77
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG-3'
d) Using this knowledge, construct a pure-breeding purple organism.
5'-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTTTTTTACTGTCGGCAGTAGTAGGGGGCGT-3'
- Explanation: In order to create a pure-breeding purple organism, I had to first find what amino acids coded for the Red and Blue alleles, dinsing them to by Phe and Tyr respectably. After figuring that out, it can be seen that purple is only present when Red and Blue cross breed with each other, so by inserting a Phe amino acid in a Blue allese DNA sequence, I was able to create a pure-breeding purple allele (one that only produces purple when it is self-crossed).
e) Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?
- Aromatic ring structures Tyrosine, Tryptophan and Phenol are the amino acids that create the color for each of the alleles and the combinations of these ring structures allow for different phenotypic differences in the color of each differing flower. That being said, if one of these amino acids are changed, the color also changes, however, if the amino acid stays the same but the sequence changes (i.e. TTT and TTC both code for Phenol) then the color remains the same.
f) Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)
- 5'-ATGCTTGTCAAGGAGATCGCCATGTATAGGTTTGCAACGCACGAACGT-3'