Difference between revisions of "Dbashour week 2"

From LMU BioDB 2017
Jump to: navigation, search
(DNA and Contemporary DNA strand created)
 
m
 
(2 intermediate revisions by the same user not shown)
Line 1: Line 1:
DNA strand  
+
==DNA==
 +
===DNA strand===
 
  5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
 
  5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Contemporary DNA Strand
+
===Contemporary DNA Strand===
 
  3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 
  3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
 +
==Translations==
 +
===+1===
 +
5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3'
 +
===+2===
 +
5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3'
 +
===+3===
 +
5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'
 +
===-1===
 +
3'- A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N - 3'
 +
===-2===
 +
3'- H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K -5'
 +
===-3===
 +
3'- I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K -5'
 +
==Open Reading Frames==
 +
+1, -2, -3 are all open reading frames
 +
==Acknowledgements==
 +
I worked with my homework partner Arash Lari on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
 +
==References==
 +
LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1
 +
==Links==
 +
{{template:dbashour}}
 +
 +
[[Category: Journal Entry]]

Latest revision as of 06:11, 12 September 2017

DNA

DNA strand

5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Contemporary DNA Strand

3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'

Translations

+1

5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3'

+2

5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3'

+3

5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'

-1

3'- A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N - 3'

-2

3'- H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K -5'

-3

3'- I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K -5'

Open Reading Frames

+1, -2, -3 are all open reading frames

Acknowledgements

I worked with my homework partner Arash Lari on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

References

LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1

Links

Dina Bashoura

Biological Databases Homepage

List of Assignments

List of Individual Journal Entries

List of Shared Journal Entries

List of Final Assignments

List of Team Journal Assignments