Difference between revisions of "Dbashour Week 3"

Revision as of 19:24, 19 September 2017

Screenshots of changed text

Screenshots of changed picture

Curl Command used to retrieve info:

curl -X POST -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa

Command used to get "just the answers"

curl -X POST -d "pre_text=cgatggtacatggagtccagtagccgtagtgatgagatcgatgagctagc&output=Verbose&code=Standard&submit=Submit" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "13q" | sed "s/<[^>]*>//g"

Links to other pages:

1. http://www.w3.org/TR/html4/loose.dtd
   • A HTML document "which includes presentation attributes and elements that W3C expects to phase out as support for style sheets matures"
2. http://web.expasy.org/favicon.ico
   • A picture of the logo used on the page tab
3. /css/sib_css/sib.css
   • A template laying out how the page should be formatted
4. /css/sib_css/sib_print.css
   • A template laying out how the page should be formatted for printing
5. /css/base.css
   • Another template for laying out the format of the page
6. http://www.isb-sib.ch
   • Link to Swiss Institute of Bioinformatics Homepage
7. http://www.expasy.org
   • Link to the ExPasy Bioinformatics Resource Portal Home
8. http://web.expasy.org/translate
   • Link to the Translate Tool page (without any input in)
9. http://en.wikipedia.org/wiki/Open_reading_frame
   • Wikipedia page for open reading frame
10. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,1
    • ExPASy translate tool highlighting open reading frames for frame 1
11. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,2
    • ExPASy translate tool highlighting open reading frames for frame 2
12. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,3
    • ExPASy translate tool highlighting open reading frames for frame 3
13. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,4
    • ExPASy translate tool highlighting open reading frames for frame 1
14. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,5
    • ExPASy translate tool highlighting open reading frames for frame 2
15. http://web.expasy.org/cgi-bin/translate/dna_sequences?/work/expasy/tmp/http/seqdna.28321,6
    • ExPASy translate tool highlighting open reading frames for frame 3
16. http://www.isb-sib.ch
    • Swiss Institute of Bioinformatics link at bottom of page
17. https://www.expasy.org/disclaimer.html
    • ExPASy disclaimer
18. https://www.google-analytics.com/ga.js
    • Java script code used within the website

Identifiers:

1. sib_top
   • The very top of the page
2. sib_container
   • The container for the whole page returned
3. sib_header_small
   • The small bar header at the top of the page
4. sib_expasy_logo
   • The logo in the top left corner of the page
5. resource_header
   • Not obvious, but possibly another formatting section for the header of the page
6. sib_header_nav
   • The top right of the page with navigational buttons to home and contact
7. sib_body
   • The portion of the page including the text and reading frames returned
8. sib_footer
   • The footer at the bottom of the page
9. sib_footer_content
   • The text/content included in the footer at the bottom of the page
10. sib_footer_right
    • The text/content in the bottom right footer of the page
11. sb_footer_gototop
    • The button going to the top of the page included in the footer

Dina Bashoura

Biological Databases Homepage

List of Assignments

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 14
• Week 15

List of Individual Journal Entries

• dbashour Week 2
• dbashour Week 3
• dbashour Week 4
• dbashour Week 5
• dbashour Week 6
• dbashour Week 7
• dbashour Week 8
• dbashour Week 9
• dbashour Week 10
• dbashour Week 11
• dbashour Week 12
• dbashour Week 14
• dbashour Week 15

List of Shared Journal Entries

• Class Journal Week 1
• Class Journal Week 2
• Class Journal Week 3
• Class Journal Week 4
• Class Journal Week 5
• Class Journal Week 6
• Class Journal Week 7
• Class Journal Week 8
• Class Journal Week 9
• Class Journal Week 10

List of Final Assignments

• dbashour Final Reflection
• Gene hAPI Deliverables
• Final Group Report

List of Team Journal Assignments

• Gene hAPI