Difference between revisions of "Dbashour week 2"
From LMU BioDB 2017
(added translations and reading frames) |
(acknowledgements, references, links) |
||
Line 19: | Line 19: | ||
==Open Reading Frames== | ==Open Reading Frames== | ||
+1, -2, -3 are all open reading frames | +1, -2, -3 are all open reading frames | ||
+ | ==Acknowledgements== | ||
+ | I worked with my homework partner [User:arashlari|Arash Lari] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source. | ||
+ | ==References== | ||
+ | LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1 | ||
+ | ==Links== | ||
+ | {{template:dbashour}} | ||
+ | |||
+ | [[Category: Journal Entry]] |
Revision as of 04:57, 12 September 2017
Contents
DNA
DNA strand
5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’
Contemporary DNA Strand
3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'
Translations
+1
5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3'
+2
5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3'
+3
5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'
-1
3' Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'
-2
3’ K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 5’
-3
3’ K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 5’
Open Reading Frames
+1, -2, -3 are all open reading frames
Acknowledgements
I worked with my homework partner [User:arashlari|Arash Lari] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
References
LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1
Links
List of Assignments
- Week 1
- Week 2
- Week 3
- Week 4
- Week 5
- Week 6
- Week 7
- Week 8
- Week 9
- Week 10
- Week 11
- Week 12
- Week 14
- Week 15
List of Individual Journal Entries
- dbashour Week 2
- dbashour Week 3
- dbashour Week 4
- dbashour Week 5
- dbashour Week 6
- dbashour Week 7
- dbashour Week 8
- dbashour Week 9
- dbashour Week 10
- dbashour Week 11
- dbashour Week 12
- dbashour Week 14
- dbashour Week 15
List of Shared Journal Entries
- Class Journal Week 1
- Class Journal Week 2
- Class Journal Week 3
- Class Journal Week 4
- Class Journal Week 5
- Class Journal Week 6
- Class Journal Week 7
- Class Journal Week 8
- Class Journal Week 9
- Class Journal Week 10
List of Final Assignments
List of Team Journal Assignments