Dbashour week 2

From LMU BioDB 2017
Revision as of 04:57, 12 September 2017 by Dbashour (talk | contribs) (acknowledgements, references, links)
Jump to: navigation, search

DNA

DNA strand

5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Contemporary DNA Strand

3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'

Translations

+1

5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3'

+2

5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3'

+3

5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'

-1

3'  Stop-N-A-S-G-T-G-G-Stop-V-I-R-G-T-Stop-Y-Stop-H-T - 3'

-2

3’  K-M-P-P-A-E-L-A-A-G-L-Y-A-E-H-G-I-S-I – 5’

-3

3’  K-C-R-Q-R-N-W-R-L-G-Y-T-R-N-M-V-L-A-Y – 5’ 

Open Reading Frames

+1, -2, -3 are all open reading frames

Acknowledgements

I worked with my homework partner [User:arashlari|Arash Lari] on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

References

LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1

Links

Dina Bashoura

Biological Databases Homepage

List of Assignments

List of Individual Journal Entries

List of Shared Journal Entries

List of Final Assignments

List of Team Journal Assignments