Dbashour week 2

DNA

DNA strand

5’-cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta-3’

Contemporary DNA Strand

3'-gcauacgauuaugguacaaggcgcauauugggucggcggucaaggcgaccgccguaaaau -5'

Translations

+1

5'- R-M-L-I-P-C-S-A-Y-N-P-A-A-S-S-A-G-G-I-L -3'

+2

5'- V-C-Stop-Y-H-V-P-R-I-T-I-Q-P-P-V-P-L-A-A-F -3'

+3

5'- Y-A-N-M-F-R-V-Stop-P-S-R-Q-F-R-W-R-H-F -3'

-1

3'- A-Y-D-Y-G-T-R-R-I-L-G-R-R-S-R-R-P-P-Stop-N - 3'

-2

3'- H-T-I-M-V-Q-G-A-Y-W-V-G-G-Q-G-D-R-R-K -5'

-3

3'- I-R-L-W-Y-K-A-H-I-G-S-A-V-K-A-T-A-V-K -5'

Open Reading Frames

+1, -2, -3 are all open reading frames

Acknowledgements

I worked with my homework partner Arash Lari on this homework assignment. We communicated via text to help eachother with the decoding of the DNA strand. While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

References

LMU BioDB 2017. (2017). Week 1. Retrieved August 29, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_1

Links

Dina Bashoura

Biological Databases Homepage

List of Assignments

• Week 1
• Week 2
• Week 3
• Week 4
• Week 5
• Week 6
• Week 7
• Week 8
• Week 9
• Week 10
• Week 11
• Week 12
• Week 14
• Week 15

List of Individual Journal Entries

• dbashour Week 2
• dbashour Week 3
• dbashour Week 4
• dbashour Week 5
• dbashour Week 6
• dbashour Week 7
• dbashour Week 8
• dbashour Week 9
• dbashour Week 10
• dbashour Week 11
• dbashour Week 12
• dbashour Week 14
• dbashour Week 15

List of Shared Journal Entries

• Class Journal Week 1
• Class Journal Week 2
• Class Journal Week 3
• Class Journal Week 4
• Class Journal Week 5
• Class Journal Week 6
• Class Journal Week 7
• Class Journal Week 8
• Class Journal Week 9
• Class Journal Week 10

List of Final Assignments

• dbashour Final Reflection
• Gene hAPI Deliverables
• Final Group Report

List of Team Journal Assignments

• Gene hAPI