Hack-a-Page

Screenshots

LMU Apply Page With Developer Tools Open

LMU Apply Page Without Developer Tools Open

Curl Code

The code I used to translate the DNA sequence from the command line was:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

Studying the curl'ed code

There are other links to other pages within the server's response:
- http://web.expasy.org/favicon.ico. This links to an icon used on the page.
- http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics".
- http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics".
- http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources.
- http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".
There are identifiers in the server's response:
- "id=sib_top" This identifies the top of the page.
- "id=sib_container" This identifies the entirety of the space the page is contained within.
- "id=sib_body" This identifies the body of the page, where the results from the translation are located.
- "id=sib_footer" This identifies where the footer of the page is.

Just the Answers

The code I used to extract just the answers from the translation was:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "s/<[^>]*>//g" | sed "14,50d"

Notebook

I started this week by working on the hacking a website section. I used LMU's apply page, and opened up the developer tools. I changed the words on screen and added a photo by uploading it to our wiki, and then by linking to it within the tools.

I made the curl code next, by figuring out that the "pre_text" needed to be the sequence of DNA and the action needed to be to submit the "TRANSLATE SEQUENCE" button.

Then, I looked at the developer tools for the response page, and found the links it contained, and the identifiers.

The last thing I did for this individual journal was make a sed code that would show only the answers. This was tricky, as I had trouble figuring out exactly the sequence I needed to get rid of the links within the lines that held what I wanted to be shown.

Acknowledgments

I worked with my homework partner, Blair Hamilton on this assignment. We met after class to work on the "hack-a-page" section of the assignment together.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.