Difference between revisions of "Mbalducc Week 3"
From LMU BioDB 2017
m (changed headers) |
(Added links found in response) |
||
| Line 18: | Line 18: | ||
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | ||
| + | |||
| + | === Studying the curl'ed code === | ||
| + | |||
| + | #There are other links to other pages within the server's response: | ||
| + | *http://web.expasy.org/favicon.ico. This links to an icon used on the page. | ||
| + | *http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics". | ||
| + | *http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics". | ||
| + | *http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources. | ||
| + | *http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame". | ||
= Acknowledgments = | = Acknowledgments = | ||
Revision as of 01:29, 18 September 2017
Contents
Hack-a-Page
Screenshots
LMU Apply Page With Developer Tools Open
LMU Apply Page Without Developer Tools Open
Curl Code
The code I used to translate the DNA sequence from the command line was:
curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa
Studying the curl'ed code
- There are other links to other pages within the server's response:
- http://web.expasy.org/favicon.ico. This links to an icon used on the page.
- http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics".
- http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics".
- http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources.
- http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".
Acknowledgments
I worked with my homework partner, Blair Hamilton on this assignment. We met after class to work on the "hack-a-page" section of the assignment together.
While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.
References
LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3
Palmo, Candace. n.d. Lion's Roar 2 [photograph]. Retrieved September 14, 2017, from https://candacepalmo.files.wordpress.com/2014/03/lions-roar-2.jpg
Other Pages
Individual Journals
No Assignment Week 13
Assignments
No Assignment Week 13
