Hack-a-Page

Screenshots

LMU Apply Page With Developer Tools Open

LMU Apply Page Without Developer Tools Open

Curl Code

The code I used to translate the DNA sequence from the command line was:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

Studying the curl'ed code

There are other links to other pages within the server's response:

http://web.expasy.org/favicon.ico. This links to an icon used on the page.
http://web.expasy.org/css/sib_css/sib.css. This links to a page with the header "Swiss Institute of Bioinformatics".
http://web.expasy.org/css/sib_css/sib_print.css. This links to another page from the "Swiss Institute of Bioinformatics".
http://web.expasy.org/css/base.css. This links to a page with the CSS for Genevian Resources.
http://en.wikipedia.org/wiki/Open_reading_frame. This links to the Wikipedia page for "Open reading frame".

Acknowledgments

I worked with my homework partner, Blair Hamilton on this assignment. We met after class to work on the "hack-a-page" section of the assignment together.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.