Mbalducc Week 3

From LMU BioDB 2017
Revision as of 00:04, 19 September 2017 by Mbalducc (talk | contribs) (Notebook)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Hack-a-Page

Screenshots

LMU Apply Page With Developer Tools Open

Mbalducc modifed page with tools.jpg


LMU Apply Page Without Developer Tools Open

Mbalducc modified page w-o tools open.jpg

Curl Code

The code I used to translate the DNA sequence from the command line was:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa

Studying the curl'ed code

  1. There are other links to other pages within the server's response:
  2. There are identifiers in the server's response:
    • "id=sib_top" This identifies the top of the page.
    • "id=sib_container" This identifies the entirety of the space the page is contained within.
    • "id=sib_body" This identifies the body of the page, where the results from the translation are located.
    • "id=sib_footer" This identifies where the footer of the page is.

Just the Answers

The code I used to extract just the answers from the translation was:

curl -d "pre_text=cgtatgctaataccatgttccgcgtataacccagccgccagttccgctggcggcatttta&submit=TRANSLATE SEQUENCE" http://web.expasy.org/cgi-bin/translate/dna_aa | sed "1,47d" | sed "s/<[^>]*>//g" | sed "14,50d"

Notebook

I started this week by working on the hacking a website section. I used LMU's apply page, and opened up the developer tools. I changed the words on screen and added a photo by uploading it to our wiki, and then by linking to it within the tools.

I made the curl code next, by figuring out that the "pre_text" needed to be the sequence of DNA and the action needed to be to submit the "TRANSLATE SEQUENCE" button.

Then, I looked at the developer tools for the response page, and found the links it contained, and the identifiers.

The last thing I did for this individual journal was make a sed code that would show only the answers. This was tricky, as I had trouble figuring out exactly the sequence I needed to get rid of the links within the lines that held what I wanted to be shown.

Acknowledgments

I worked with my homework partner, Blair Hamilton on this assignment. We met after class to work on the "hack-a-page" section of the assignment together.

While I worked with the people noted above, this individual journal entry was completed by me and not copied from another source.

References

LMU BioDB 2017. (2017). Week 3. Retrieved September 14, 2017, from https://xmlpipedb.cs.lmu.edu/biodb/fall2017/index.php/Week_3

Palmo, Candace. n.d. Lion's Roar 2 [photograph]. Retrieved September 14, 2017, from https://candacepalmo.files.wordpress.com/2014/03/lions-roar-2.jpg

Other Pages

Individual Journals

Mary Balducci

Week 2 Journal

Week 3 Journal

Week 4 Journal

Week 5 Journal

Week 6 Journal

Week 7 Journal

Week 8 Journal

Week 9 Journal

Week 10 Journal

Week 11 Journal

Week 12 Journal

No Assignment Week 13

Week 14 Journal

Week 15 Journal


Assignments

Week 1 Assignment

Week 2 Assignment

Week 3 Assignment

Week 4 Assignment

Week 5 Assignment

Week 6 Assignment

Week 7 Assignment

Week 8 Assignment

Week 9 Assignment

Week 10 Assignment

Week 11 Assignment

Week 12 Assignment

No Assignment Week 13

Week 14 Assignment

Week 15 Assignment

Shared Journals

Class Journal Week 1

Class Journal Week 2

Class Journal Week 3

Class Journal Week 4

Class Journal Week 5

Class Journal Week 6

Class Journal Week 7

Class Journal Week 8

Class Journal Week 9

Class Journal Week 10

Page Desiigner