Difference between revisions of "ASP1/YDR321W Week 3"
(Started Gene summary) |
(→Acknowledgements: added signature) |
||
(31 intermediate revisions by 2 users not shown) | |||
Line 6: | Line 6: | ||
===Gene Summary=== | ===Gene Summary=== | ||
− | + | ASP1 / YDR321W is a gene that codes for a cytosolic L-asparaginase. This protein catalyzes the hydrolysis of L-asparagine into aspartate and ammonia during the asparagine catabolic pathway. Researchers are studying ASP1 / YDR321W to learn of its effects on lymphoblastic leukemia and how its transcription levels can be down regulated to help starve cancer cells. This gene isi located on Chromosome IV of Saccharomyces cerevisiae (Position 1,108,702-1,109,847). ASP1 / YDR321W is one of two L-asparaginases, and the only asparaginase found in the cytoplasm. | |
+ | |||
+ | ===Additional Gene Information=== | ||
+ | ====Gene Naming==== | ||
+ | *Standard Name: ASP1 | ||
+ | *Systematic Name: YDR321W | ||
+ | *Name Description: ASParaginaase | ||
+ | |||
+ | ====Gene Identifier Codes==== | ||
+ | *SGD ID: [https://www.yeastgenome.org/locus/S000002729#history S000002729] | ||
+ | *NCBI ID: [https://www.ncbi.nlm.nih.gov/gene/851920 851920] | ||
+ | *Ensembl ID: [https://uswest.ensembl.org/Saccharomyces_cerevisiae/Gene/Summary?db=core;g=YDR321W;r=IV:1108702-1109847;t=YDR321W_mRNA R64-1-1:BK006938.2] | ||
+ | *uniProt ID: [https://www.uniprot.org/uniprot/P38986 P38986] | ||
+ | |||
+ | ====Gene DNA Sequence==== | ||
+ | * >ASP1 YDR321W SGDID:S000002729, chrIV:1108702..1109847 | ||
+ | ATGAAAAGCGATTCAGTTGAAATCACTACCATCTGCCCAGATGTTGAAAATTCTCAGTTT | ||
+ | GTTGTGCAAAGCAACTGTCCAGAGACTATTCCAGAGATTCTAAAGTCTCAAAATGCCGCT | ||
+ | GTGAATGGCAGCGGCATCGCTTGCCAACAACGTAGCTTACCAAGAATCAAAATCTTGGGT | ||
+ | ACCGGTGGTACTATTGCATCGAAAGCTATAGACTCCTCTCAAACTGCCGGCTATCATGTT | ||
+ | GACCTGACCATCCAAGATCTATTGGATGCCATTCCAGATATATCCAAGGTCTGTGACATT | ||
+ | GAATATGAGCAACTATGCAACGTGGATTCTAAAGACATAAACGAGGATATTCTTTATAAA | ||
+ | ATTTATAAGGGCGTCTCAGAATCGTTGCAGGCTTTTGACGGTATAGTTATTACCCATGGG | ||
+ | ACTGATACGCTATCTGAAACTGCATTCTTTATTGAAAGTACTATTGATGCTGGCGACGTT | ||
+ | CCTATTGTTTTTGTTGGTTCGATGCGTCCTTCAACCAGCGTTTCTGCTGATGGCCCTATG | ||
+ | AACCTTTACCAAGCAATTTGCATTGCTTCAAATCCAAAATCTAGAGGAAGAGGTGTTCTT | ||
+ | GTTTCCTTGAATGACCAAATTTCCTCTGGTTACTACATTACTAAGACGAATGCAAATAGT | ||
+ | TTGGATTCTTTTAATGTTAGACAAGGCTATTTAGGAAATTTTGTCAACAATGAAATTCAC | ||
+ | TACTATTATCCTCCTGTGAAACCGCAAGGTTGCCACAAATTCAAACTGAGAGTGGACGGT | ||
+ | AAGCATTTTAAATTACCAGAGGTTTGCATTTTATATGCTCACCAAGCCTTTCCGCCAGCT | ||
+ | ATAGTCAACTTAGTGGCAGATAAGTATGATGGTATTGTTCTTGCTACCATGGGTGCTGGT | ||
+ | TCATTGCCGGAGGAGGTCAATGAAACCTGCATGAAATTGAGTTTGCCGATCGTATATTCC | ||
+ | AAGAGATCGATGGATGGTATGGTGCCTATTGCCAACGTACCAAAGAAAGGTTCAAAGGAG | ||
+ | GATAATCTCATCGCATCTGGTTATCTAAGCCCTGAAAAGAGCAGAATCTTGTTACAATTA | ||
+ | TGTTTGGCAGGTAACTACACGTTGGAAGAAATTAAACATGTTTTCACTGGCGTCTATGGT | ||
+ | GGGTGA | ||
+ | |||
+ | ====Protein Sequence Corresponding With Gene==== | ||
+ | [[ Image:Eyoung20ASP1-YDR321Wprotiensequence.png | frame | center | 150px | Frame 1 is the correct protein sequence ]] | ||
+ | |||
+ | ====Function of Gene==== | ||
+ | *Our gene is involved in the catabolism of asparagine, specifically it is a catalyst for the hydrolysis of L-asparagine. It helps break down L-asparagine into aspartic acid and ammonia. It has been shown to be an important enzyme in the treatment of lymphoblastic Leukemia. | ||
+ | |||
+ | ====Information Across Databases==== | ||
+ | * There were no major differences in content throughout the databases that we noticed they all seemed to cover the same general categories of information. There were small differences within the more specific content though. Also the data from each Site seemed to come from different sources. | ||
+ | *The presentation of information did vary greatly from site to site some seemed to use a bare bones way to display the information like NCBI Gene, others like SGD had a very pleasing wed design. while UniProt was more focussed on the chemistry side, Ensembl was more focused on organism wide interaction, NCBI Gene focused more on the genetics. SGD seemed to be more holistic in what information they presented. | ||
+ | |||
+ | ====Why did you choose this Gene?==== | ||
+ | * We chose this gene because we were interested in finding a gene that had practical applications that we don't always think of when we think of yeast. We knew that yeast had large amounts of varied applications and we wanted to know more. We were especially interested in how yeast genes could be used to fight human diseases, so we looked through the yeast and human disease section of the SGD site. On that page we found ASP1 and how it could be used to fight forms of cancer by cutting off a source of energy to cancer cells, so we choose to do the project on ASP1 because it hit all our points of interest. | ||
+ | |||
+ | ====Image of Gene Protein==== | ||
+ | [[File:Firstglance_animation_1_ASP1.gif]] | ||
+ | |||
+ | ===Acknowledgements=== | ||
+ | *I, Michael Armas, would like to acknowledge my homework partner, Emma Young, for helping with the gathering of data as well as for the creation of this page. | ||
+ | *I, Emma Young would like to acknowledge my homework partner, Micheal Armas, for helping with the gathering of data as well as for the creation of this page. | ||
+ | '''Except for what is noted above, this individual journal entry was completed by me and not copied from another source.'''<br> | ||
+ | [[User:Marmas|Marmas]] ([[User talk:Marmas|talk]]) 21:49, 18 September 2019 (PDT)<br> | ||
+ | [[User:Eyoung20|Eyoung20]] ([[User talk:Eyoung20|talk]]) 21:55, 18 September 2019 (PDT) | ||
+ | |||
+ | ===References=== | ||
+ | Gene: YDR321W. (2019, July). Retrieved from https://uswest.ensembl.org/Saccharomyces_cerevisiae/Gene/Summary?db=core;g<br> | ||
+ | ASP1 / YDR321W. (n.d.). Retrieved from https://www.yeastgenome.org/locus/S000002729<br> | ||
+ | ASP1 asparaginase [Saccharomyces cerevisiae S288C] - Gene - NCBI. (2019, September 8). Retrieved from https://www.ncbi.nlm.nih.gov/gene/851920<br> | ||
+ | Starr, B. (2017, March 2). Feed a Cold, Starve a Cancer? Retrieved from https://www.yeastgenome.org/blog/category/yeast-and-human-disease<br> | ||
+ | UniProt ConsortiumEuropean Bioinformatics InstituteProtein Information ResourceSIB Swiss Institute of Bioinformatics. (2019, September 18). L-asparaginase 1. Retrieved from https://www.uniprot.org/uniprot/P38986van |
Latest revision as of 21:55, 18 September 2019
Contents
ASP1/YDR321W
Gene Summary
ASP1 / YDR321W is a gene that codes for a cytosolic L-asparaginase. This protein catalyzes the hydrolysis of L-asparagine into aspartate and ammonia during the asparagine catabolic pathway. Researchers are studying ASP1 / YDR321W to learn of its effects on lymphoblastic leukemia and how its transcription levels can be down regulated to help starve cancer cells. This gene isi located on Chromosome IV of Saccharomyces cerevisiae (Position 1,108,702-1,109,847). ASP1 / YDR321W is one of two L-asparaginases, and the only asparaginase found in the cytoplasm.
Additional Gene Information
Gene Naming
- Standard Name: ASP1
- Systematic Name: YDR321W
- Name Description: ASParaginaase
Gene Identifier Codes
- SGD ID: S000002729
- NCBI ID: 851920
- Ensembl ID: R64-1-1:BK006938.2
- uniProt ID: P38986
Gene DNA Sequence
- >ASP1 YDR321W SGDID:S000002729, chrIV:1108702..1109847
ATGAAAAGCGATTCAGTTGAAATCACTACCATCTGCCCAGATGTTGAAAATTCTCAGTTT GTTGTGCAAAGCAACTGTCCAGAGACTATTCCAGAGATTCTAAAGTCTCAAAATGCCGCT GTGAATGGCAGCGGCATCGCTTGCCAACAACGTAGCTTACCAAGAATCAAAATCTTGGGT ACCGGTGGTACTATTGCATCGAAAGCTATAGACTCCTCTCAAACTGCCGGCTATCATGTT GACCTGACCATCCAAGATCTATTGGATGCCATTCCAGATATATCCAAGGTCTGTGACATT GAATATGAGCAACTATGCAACGTGGATTCTAAAGACATAAACGAGGATATTCTTTATAAA ATTTATAAGGGCGTCTCAGAATCGTTGCAGGCTTTTGACGGTATAGTTATTACCCATGGG ACTGATACGCTATCTGAAACTGCATTCTTTATTGAAAGTACTATTGATGCTGGCGACGTT CCTATTGTTTTTGTTGGTTCGATGCGTCCTTCAACCAGCGTTTCTGCTGATGGCCCTATG AACCTTTACCAAGCAATTTGCATTGCTTCAAATCCAAAATCTAGAGGAAGAGGTGTTCTT GTTTCCTTGAATGACCAAATTTCCTCTGGTTACTACATTACTAAGACGAATGCAAATAGT TTGGATTCTTTTAATGTTAGACAAGGCTATTTAGGAAATTTTGTCAACAATGAAATTCAC TACTATTATCCTCCTGTGAAACCGCAAGGTTGCCACAAATTCAAACTGAGAGTGGACGGT AAGCATTTTAAATTACCAGAGGTTTGCATTTTATATGCTCACCAAGCCTTTCCGCCAGCT ATAGTCAACTTAGTGGCAGATAAGTATGATGGTATTGTTCTTGCTACCATGGGTGCTGGT TCATTGCCGGAGGAGGTCAATGAAACCTGCATGAAATTGAGTTTGCCGATCGTATATTCC AAGAGATCGATGGATGGTATGGTGCCTATTGCCAACGTACCAAAGAAAGGTTCAAAGGAG GATAATCTCATCGCATCTGGTTATCTAAGCCCTGAAAAGAGCAGAATCTTGTTACAATTA TGTTTGGCAGGTAACTACACGTTGGAAGAAATTAAACATGTTTTCACTGGCGTCTATGGT GGGTGA
Protein Sequence Corresponding With Gene
Function of Gene
- Our gene is involved in the catabolism of asparagine, specifically it is a catalyst for the hydrolysis of L-asparagine. It helps break down L-asparagine into aspartic acid and ammonia. It has been shown to be an important enzyme in the treatment of lymphoblastic Leukemia.
Information Across Databases
- There were no major differences in content throughout the databases that we noticed they all seemed to cover the same general categories of information. There were small differences within the more specific content though. Also the data from each Site seemed to come from different sources.
- The presentation of information did vary greatly from site to site some seemed to use a bare bones way to display the information like NCBI Gene, others like SGD had a very pleasing wed design. while UniProt was more focussed on the chemistry side, Ensembl was more focused on organism wide interaction, NCBI Gene focused more on the genetics. SGD seemed to be more holistic in what information they presented.
Why did you choose this Gene?
- We chose this gene because we were interested in finding a gene that had practical applications that we don't always think of when we think of yeast. We knew that yeast had large amounts of varied applications and we wanted to know more. We were especially interested in how yeast genes could be used to fight human diseases, so we looked through the yeast and human disease section of the SGD site. On that page we found ASP1 and how it could be used to fight forms of cancer by cutting off a source of energy to cancer cells, so we choose to do the project on ASP1 because it hit all our points of interest.
Image of Gene Protein
Acknowledgements
- I, Michael Armas, would like to acknowledge my homework partner, Emma Young, for helping with the gathering of data as well as for the creation of this page.
- I, Emma Young would like to acknowledge my homework partner, Micheal Armas, for helping with the gathering of data as well as for the creation of this page.
Except for what is noted above, this individual journal entry was completed by me and not copied from another source.
Marmas (talk) 21:49, 18 September 2019 (PDT)
Eyoung20 (talk) 21:55, 18 September 2019 (PDT)
References
Gene: YDR321W. (2019, July). Retrieved from https://uswest.ensembl.org/Saccharomyces_cerevisiae/Gene/Summary?db=core;g
ASP1 / YDR321W. (n.d.). Retrieved from https://www.yeastgenome.org/locus/S000002729
ASP1 asparaginase [Saccharomyces cerevisiae S288C] - Gene - NCBI. (2019, September 8). Retrieved from https://www.ncbi.nlm.nih.gov/gene/851920
Starr, B. (2017, March 2). Feed a Cold, Starve a Cancer? Retrieved from https://www.yeastgenome.org/blog/category/yeast-and-human-disease
UniProt ConsortiumEuropean Bioinformatics InstituteProtein Information ResourceSIB Swiss Institute of Bioinformatics. (2019, September 18). L-asparaginase 1. Retrieved from https://www.uniprot.org/uniprot/P38986van