Difference between revisions of "RAD53 / YPL153C Week 3"

From LMU BioDB 2019
Jump to navigation Jump to search
(Added syntax from wrong named page. The previous page did not have our gene name)
 
(References addition)
 
(29 intermediate revisions by 2 users not shown)
Line 5: Line 5:
 
===Summary of RAD53/ YPL153C:===
 
===Summary of RAD53/ YPL153C:===
  
RAD53 is a DNA damage response. It is required for cell cycle arrest. Its signal transduction pathway component is required for DNA damage and replication.  
+
RAD53 is a DNA damage response. It is required for cell cycle arrest. Its signal transduction pathway component is required for DNA damage and replication. More specifically, it controls S, G1, and G2 DNA checkpoints. It is a homologue to the CHEK2 which is found in humans and can be used to study breast cancer.
  
The summary should be one paragraph about the function of your gene based on what you have read in each of the four databases. This is one paragraph that synthesizes information, not one paragraph per database.
+
===1. Standard name, systematic name, and name description for your gene (from SGD)?===
 
 
===Standard name, systematic name, and name description for your gene (from SGD)?===
 
  
 
Standard Name: Rad53
 
Standard Name: Rad53
Line 17: Line 15:
 
Name Description: RADiation sensitive  
 
Name Description: RADiation sensitive  
  
It is a DNA damage response kinase and plays a role in the initiation of DNA replication
+
It is a DNA damage response kinase and plays a role in the initiation of DNA replication.
  
===Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?===
+
===2. Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?===
  
 
Gene ID in SGD: S000006074
 
Gene ID in SGD: S000006074
Line 31: Line 29:
 
All 4 databases use the same Gene ID
 
All 4 databases use the same Gene ID
  
===DNA sequence of your gene?===
+
===3. DNA sequence of your gene?===
 
ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT
 
ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT
 
GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG
 
GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG
Line 75: Line 73:
 
TCGTAA
 
TCGTAA
  
===Protein sequence corresponding to your gene?===
+
===4. Protein sequence corresponding to your gene?===
 +
 
 +
[[File:Tesfaiohannes.SEQUENCE..jpg|900px| Translation of the DNA sequence RAD53 from expasy.org]]
  
[[File:Tesfaiohannes DNA translation.png|500px|thumb|middle| Translation of the DNA sequence RAD53]]
 
 
Frame 1 5'3' encodes the entire protein sequence
 
Frame 1 5'3' encodes the entire protein sequence
  
 
https://web.expasy.org/translate/
 
https://web.expasy.org/translate/
  
===Function of your gene?===
+
===5. Function of your gene?===
  
 
RAD53 encodes for a protein kinase which is required for the cell cycle checkpoint. It amplifies the initial signals for proteins that recognize DNA damage. A loss in RAD53 can lead to defects in checkpoint activation.
 
RAD53 encodes for a protein kinase which is required for the cell cycle checkpoint. It amplifies the initial signals for proteins that recognize DNA damage. A loss in RAD53 can lead to defects in checkpoint activation.
  
===What was different about the information provided about your gene in each of the parent databases?===
+
===6. What was different about the information provided about your gene in each of the parent databases?===
 +
The UniProt database gave the most detail about where it functions in DNA damage checkpoints. SGD itself and Ensembl provided many more generalized functions that the genes are believed to be involved in without going into much detail. NCBI gave more information about mapping the gene and wasn't as straight forward about the functions.
  
 
===Were there differences in content, the information or data itself?===
 
===Were there differences in content, the information or data itself?===
 +
The difference in content was mainly in the more generalized or more specific functions given on the databases. For example, Uniprot gave detailed information specific to the gene's involvement with DNA damage checkpoints. Although the other databases did mention its involvement with DNA damage, it did not go into specifics but gave more functions that it is involved with. All databases were consistent with the gene's use in the study of breast cancer.
  
 
===Were there differences in presentation of the information?===
 
===Were there differences in presentation of the information?===
 +
NCBI did the best job at presenting the information so that you could scroll through one page and see all the data there was to offer. It was the most difficult to understand what the gene's role was. SGD and UnitProt had the best visual view of the gene and information. Ensembl was the most confusing to navigate in terms of different links to click on to find more information.
  
===Why did you choose your particular gene? i.e., why is it interesting to you and your partner?===
+
===7. Why did you choose your particular gene? i.e., why is it interesting to you and your partner?===
 +
We wanted to research a gene that was relatable to the field of health and the pursuit of eradicating a disease, such as cancer. We chose the RAD53/YPL153C gene because of its involvement in the study of breast cancer. It being homologous to human CHEK2 has allowed it to be used in learning more about the nature of breast cancer and treatment.
  
Include an image related to your gene (be careful that you do not violate any copyright restrictions!)
+
===8. Include an image related to your gene===
Please make the image something scientific (not like the random images seen on the SGD blog posts).
+
 
If a 3D structure of the protein your gene encodes is available, you can choose to embed a rotating image of the structure on your page using the FirstGlance in Jmol software. This is optional, a different static image would be OK, too.
+
[[Image:genepic.png|300px|RAD53 Image]]
 +
 
 +
Image of the RAD53 gene
  
 
===Acknowledgments===
 
===Acknowledgments===
Both partners should sign the Academic Honesty statement with their wiki signatures.
 
You need to cite the specific database page from which you derived your information for each of the questions.
 
When answering the free-form questions, be sure to paraphrase.
 
  
 +
*We worked together during multiple classes and met once outside of class to collaborate on the different databases information. For the beginning of this assignment, work was saved on the wiki page [[Cdomin12 and Ntesfaio Week 3]]. However, the name of the week 3 individual assignment was to be named after the gene. The proper name was then changed to [[RAD53 / YPL153C Week 3]] and the syntax that was edited on the previous page was transferred over to this page. Previous saves can be seen in the "view history" tab of the page [[Cdomin12 and Ntesfaio Week 3]].
  
 
"Except for what is noted above, this individual journal entry was completed by me and not copied from another source."
 
"Except for what is noted above, this individual journal entry was completed by me and not copied from another source."
 +
[[User:Ntesfaio|Ntesfaio]] ([[User talk:Ntesfaio|talk]]) 16:34, 16 September 2019 (PDT)
  
[[User:Ntesfaio|Ntesfaio]] ([[User talk:Ntesfaio|talk]]) 16:34, 16 September 2019 (PDT)
+
"Except for what is noted above, this individual journal entry was completed by me and not copied from another source."
 +
[[User:Cdomin12|Cdomin12]] ([[User talk:Cdomin12|talk]]) 21:10, 17 September 2019 (PDT)
  
 
===References===  
 
===References===  
 +
 +
#ExPASy Translator. Retrieved September 17,2019 from [[https://web.expasy.org/translate/|visible EXPASy]]
 +
#SGD Database. Retrieved September 17,2019 from [[https://www.yeastgenome.org/locus/S000006074|visible SGD Rad53]]
 +
#NCBI Database. Retrieved September 17,2019 from [[https://www.ncbi.nlm.nih.gov/gene/855950|visible NCBI Rad53]]
 +
#UniProt Database. Retrieved September 17, 2019 from [[https://www.uniprot.org/uniprot/P22216|Uniprot Rad53]]
 +
#Ensembl Database. Retrieved September 17, 2019 from [[https://uswest.ensembl.org/Saccharomyces_cerevisiae/Gene/Summary?db=core;g=YPL153C;r=XVI:261727-264192;t=YPL153C_mRNA|Ensembl Rad53]]
 +
#[[Week 3]] Assignment page is: LMU BioDB 2019. (2019). Week 3. Retrieved September 17, 2019 from [[https://xmlpipedb.cs.lmu.edu/biodb/fall2019/index.php/Week_3|visible Week 3]]
  
 
[[Category: Journal Entry]]
 
[[Category: Journal Entry]]
  
 
{{Template: Ntesfaio}}
 
{{Template: Ntesfaio}}
 +
 +
{{template:cdomin12}}

Latest revision as of 21:18, 17 September 2019

My Favorite Gene

Christina Dominguez and Naomi Tesfaiohannes

Summary of RAD53/ YPL153C:

RAD53 is a DNA damage response. It is required for cell cycle arrest. Its signal transduction pathway component is required for DNA damage and replication. More specifically, it controls S, G1, and G2 DNA checkpoints. It is a homologue to the CHEK2 which is found in humans and can be used to study breast cancer.

1. Standard name, systematic name, and name description for your gene (from SGD)?

Standard Name: Rad53

Systematic Name: YPL153C

Name Description: RADiation sensitive

It is a DNA damage response kinase and plays a role in the initiation of DNA replication.

2. Gene ID (identifier) for your gene in all four databases (SGD, NCBI Gene, Ensembl, UniProt)?

Gene ID in SGD: S000006074

Gene ID in NCBI: S000006074

Gene ID in Ensembl: S000006074

Gene ID in UniProt: S000006074

All 4 databases use the same Gene ID

3. DNA sequence of your gene?

ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG GGTCAAATTCCCATCCGAGATTTGTCAGCTGATATTTCACAAGTGCTTAAGGAAAAACGA TCCATAAAGAAAGTTTGGACATTTGGTAGAAACCCAGCCTGTGACTATCATTTAGGAAAC ATTTCAAGACTGTCAAATAAGCATTTCCAAATACTACTAGGAGAAGACGGTAACCTTTTA TTGAATGACATTTCCACTAATGGGACCTGGTTAAATGGGCAAAAAGTCGAGAAGAACAGC AATCAGTTACTGTCTCAAGGTGATGAAATAACCGTTGGTGTAGGCGTGGAATCAGATATT TTATCTCTGGTCATTTTCATAAACGACAAATTTAAGCAGTGCCTCGAGCAGAACAAAGTT GATCGCATAAGATCTAACCTGAAAAATACCTCTAAAATAGCTTCTCCTGGTCTTACATCA TCTACTGCATCATCAATGGTGGCCAACAAGACTGGTATTTTTAAGGATTTTTCGATTATT GACGAAGTGGTGGGCCAGGGTGCATTTGCCACAGTAAAGAAAGCCATTGAAAGAACTACT GGGAAAACATTCGCGGTGAAGATTATAAGTAAACGCAAAGTAATAGGCAATATGGATGGT GTGACAAGAGAGTTAGAAGTATTGCAAAAGCTCAATCATCCAAGGATAGTACGATTGAAA GGATTTTATGAAGATACTGAGAGTTATTATATGGTGATGGAGTTCGTTTCTGGTGGTGAC TTAATGGATTTTGTTGCTGCTCATGGTGCGGTTGGAGAAGATGCTGGGAGGGAGATATCC AGGCAGATACTCACAGCAATAAAATACATTCACTCTATGGGCATCAGCCATCGTGACCTA AAGCCCGATAATATTCTTATTGAACAAGACGATCCTGTATTGGTAAAGATAACCGACTTT GGTCTGGCAAAAGTACAAGGAAATGGGTCTTTTATGAAAACCTTCTGTGGCACTTTGGCA TATGTGGCACCTGAAGTCATCAGAGGTAAAGATACATCCGTATCTCCTGATGAATACGAA GAAAGGAATGAGTACTCTTCGTTAGTGGATATGTGGTCAATGGGATGTCTTGTGTATGTT ATCCTAACGGGCCACTTACCTTTTAGTGGTAGCACACAGGACCAATTATATAAACAGATT GGAAGAGGCTCATATCATGAAGGGCCCCTCAAAGATTTCCGGATATCTGAAGAAGCAAGA GATTTCATAGATTCATTGTTACAGGTGGATCCAAATAATAGGTCGACAGCTGCAAAAGCC TTGAATCATCCCTGGATCAAGATGAGTCCATTGGGCTCACAATCATATGGTGATTTTTCA CAAATATCCTTATCACAATCGTTGTCGCAGCAGAAATTATTAGAAAATATGGACGATGCT CAATACGAATTTGTCAAAGCGCAAAGGAAATTACAAATGGAGCAACAACTTCAAGAACAG GATCAGGAAGACCAAGATGGAAAAATTCAAGGATTTAAAATACCCGCACACGCCCCTATT CGATATACACAGCCCAAAAGCATTGAAGCAGAAACTAGAGAACAAAAACTTTTACATTCC AATAATACTGAGAATGTCAAGAGCTCAAAGAAAAAGGGTAATGGTAGGTTTTTAACTTTA AAACCATTGCCTGACAGCATTATTCAAGAAAGCCTGGAGATTCAGCAAGGTGTGAATCCA TTTTTCATTGGTAGATCCGAGGATTGCAATTGTAAAATTGAAGACAATAGGTTGTCTCGA GTTCATTGCTTCATTTTCAAAAAGAGGCATGCTGTAGGCAAAAGCATGTATGAATCTCCG GCACAAGGTTTAGATGATATTTGGTATTGCCACACCGGAACTAACGTGAGCTATTTAAAT AATAACCGCATGATACAGGGTACGAAATTCCTTTTACAAGACGGAGATGAAATCAAGATC ATTTGGGATAAAAACAATAAATTTGTCATTGGCTTTAAAGTGGAAATTAACGATACTACA GGTCTGTTTAACGAGGGATTAGGTATGTTACAAGAACAAAGAGTAGTACTTAAGCAAACA GCCGAAGAAAAAGATTTGGTGAAAAAGTTAACCCAGATGATGGCAGCTCAACGTGCAAAT CAACCCTCGGCTTCTTCTTCATCAATGTCGGCTAAGAAGCCGCCAGTTAGCGATACAAAT AATAACGGCAATAATTCGGTACTAAACGACTTGGTAGAGTCACCGATTAATGCGAATACG GGGAACATTTTGAAGAGAATACATTCGGTAAGTTTATCGCAATCACAAATTGATCCTAGT AAGAAGGTTAAAAGGGCAAAATTGGACCAAACCTCAAAAGGCCCCGAGAATTTGCAATTT TCGTAA

4. Protein sequence corresponding to your gene?

Translation of the DNA sequence RAD53 from expasy.org

Frame 1 5'3' encodes the entire protein sequence

https://web.expasy.org/translate/

5. Function of your gene?

RAD53 encodes for a protein kinase which is required for the cell cycle checkpoint. It amplifies the initial signals for proteins that recognize DNA damage. A loss in RAD53 can lead to defects in checkpoint activation.

6. What was different about the information provided about your gene in each of the parent databases?

The UniProt database gave the most detail about where it functions in DNA damage checkpoints. SGD itself and Ensembl provided many more generalized functions that the genes are believed to be involved in without going into much detail. NCBI gave more information about mapping the gene and wasn't as straight forward about the functions.

Were there differences in content, the information or data itself?

The difference in content was mainly in the more generalized or more specific functions given on the databases. For example, Uniprot gave detailed information specific to the gene's involvement with DNA damage checkpoints. Although the other databases did mention its involvement with DNA damage, it did not go into specifics but gave more functions that it is involved with. All databases were consistent with the gene's use in the study of breast cancer.

Were there differences in presentation of the information?

NCBI did the best job at presenting the information so that you could scroll through one page and see all the data there was to offer. It was the most difficult to understand what the gene's role was. SGD and UnitProt had the best visual view of the gene and information. Ensembl was the most confusing to navigate in terms of different links to click on to find more information.

7. Why did you choose your particular gene? i.e., why is it interesting to you and your partner?

We wanted to research a gene that was relatable to the field of health and the pursuit of eradicating a disease, such as cancer. We chose the RAD53/YPL153C gene because of its involvement in the study of breast cancer. It being homologous to human CHEK2 has allowed it to be used in learning more about the nature of breast cancer and treatment.

8. Include an image related to your gene

RAD53 Image

Image of the RAD53 gene

Acknowledgments

  • We worked together during multiple classes and met once outside of class to collaborate on the different databases information. For the beginning of this assignment, work was saved on the wiki page Cdomin12 and Ntesfaio Week 3. However, the name of the week 3 individual assignment was to be named after the gene. The proper name was then changed to RAD53 / YPL153C Week 3 and the syntax that was edited on the previous page was transferred over to this page. Previous saves can be seen in the "view history" tab of the page Cdomin12 and Ntesfaio Week 3.

"Except for what is noted above, this individual journal entry was completed by me and not copied from another source." Ntesfaio (talk) 16:34, 16 September 2019 (PDT)

"Except for what is noted above, this individual journal entry was completed by me and not copied from another source." Cdomin12 (talk) 21:10, 17 September 2019 (PDT)

References

  1. ExPASy Translator. Retrieved September 17,2019 from [EXPASy]
  2. SGD Database. Retrieved September 17,2019 from [SGD Rad53]
  3. NCBI Database. Retrieved September 17,2019 from [NCBI Rad53]
  4. UniProt Database. Retrieved September 17, 2019 from [Rad53]
  5. Ensembl Database. Retrieved September 17, 2019 from [Rad53]
  6. Week 3 Assignment page is: LMU BioDB 2019. (2019). Week 3. Retrieved September 17, 2019 from [Week 3]

Bio DB Home page

Template:Ntesfaio

Week 1

User:Ntesfaio

Class Journal Week 1

Week 2

Ntesfaio Week 2

Class Journal Week 2

Week 3

RAD53 / YPL153C Week 3

Class Journal Week 3


Week 4

Ntesfaio Week 4

Class Journal Week 4

Week 5

DrugCentral Week 5

Class Journal Week 5

Week 6

Ntesfaio Week 6

Class Journal Week 6

Week 7

Ntesfaio Week 7

Class Journal Week 7

Week 8

Ntesfaio Week 8

Class Journal Week 8

Week 9

Ntesfaio Week 9

Class Journal Week 9

Week 10

Ntesfaio Week 10

Week 11

Ntesfaio Week 11

Sulfiknights

Week 12/13

Ntesfaio Week 12/13

Sulfiknights

Sulfiknights Deliverables

Ntesfaio Week 15

Ntesfaio Final Individual Reflection

User Page

template: cdomin12

Assignment Page Individual Journal Entries Class Journal
Week 1 cdomin12 Week 1 Class Journal Week 1
Week 2 cdomin12 Week 2 Class Journal Week 2
Week 3 RAD53 / YPL153C Week 3 Class Journal Week 3
Week 4 cdomin12 Week 4 Class Journal Week 4
Week 5 IMG/VR Week 5 Class Journal Week 5
Week 6 cdomin12 Week 6 Class Journal Week 6
Week 7 cdomin12 Week 7 Class Journal Week 7
Week 8 cdomin12 Week 8 Class Journal Week 8
Week 9 cdomin12 Week 9 Class Journal Week 9
Week 10 cdomin12 Week 10 Class Journal Week 10
Week 11 cdomin12 Week 11 Skinny Genes
Week 12/13 Skinny Genes Quality Assurance Skinny Genes
Week 15 Skinny Genes Deliverables Skinny Genes