Difference between revisions of "Msamdars Week 2"
(→Acknowledgement) |
(→Electronic Lab Notebook: add Task D) |
||
| Line 7: | Line 7: | ||
# Loaded each allele in to Aipotu | # Loaded each allele in to Aipotu | ||
# Created pure-breeding species by continuously self-breeding each initial flower in the Genetics tab. | # Created pure-breeding species by continuously self-breeding each initial flower in the Genetics tab. | ||
| − | # Created hybrids between each pure-breeding flower and a pure-breeding | + | # Created hybrids between each pure-breeding homozygous flower and a pure-breeding homozygous White flower |
# Compared each of these hybrids's DNA seq by using built in compare tool, shown in a screenshot below. | # Compared each of these hybrids's DNA seq by using built in compare tool, shown in a screenshot below. | ||
# Compared each of the amino acid sequences by hand, copying the sequence over from the Molecular Bio screen into the table in the Results section. | # Compared each of the amino acid sequences by hand, copying the sequence over from the Molecular Bio screen into the table in the Results section. | ||
====Task B==== | ====Task B==== | ||
| − | # Loaded sample by double-clicking on White flower organism in Greenhouse (molecular biology tab | + | # Loaded sample by double-clicking on White flower organism in Greenhouse (molecular biology tab in Aipotu pictured on right). |
# Compared sequence using compare tool | # Compared sequence using compare tool | ||
| Line 18: | Line 18: | ||
# Loaded each sample into the Molecular Biology tab. | # Loaded each sample into the Molecular Biology tab. | ||
# Examined and recorded the color boxes in bottom right of each sample window for each organism. | # Examined and recorded the color boxes in bottom right of each sample window for each organism. | ||
| + | |||
| + | ====Task D==== | ||
| + | # Created a cross of pure-breeding homozygous Blue flower and pure-breeding homozygous Red flower. | ||
| + | # Compared the proteins synthesized by the co-dominant alleles of the hybrid Purple flower. | ||
| + | # Determined the difference between the two proteins | ||
| + | # Created hypothesis that adding amino acids with aromatic groups (specifically Phenylalanine from the Blue allele) around locations of amino acids with aromatic groups would change color. | ||
| + | #* This is also similar in location to the locations where most of the variation between the alleles happens. | ||
| + | # Tested hypothesis | ||
| + | # Recorded result | ||
===Results=== | ===Results=== | ||
| Line 86: | Line 95: | ||
====Task D==== | ====Task D==== | ||
| + | A purple flower is created by adding Phenylalanine codon to the DNA that encodes the Red allele, or a Tyrosine codon to the DNA that encodes the Blue protein. An example with the DNA fragment that encodes the Red allele is shown below, with the position of the codon underlined and in red. The amino acid sequence is shown below as well, with the position of the addition of Phenylalanine underlined and in red. | ||
| + | |||
| + | <code>CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTG<u style="color: red">'''TAT'''</u>TTCTGTCGGCAGTAGTAGGGGGCGT</code> | ||
| − | + | <code>N-MetSerAsnArgHisIleLeuLeuVal<u style="color: red">'''Tyr'''</u>PheCysArgGln-C</code> | |
| − | |||
====Task E==== | ====Task E==== | ||
Revision as of 21:50, 10 September 2019
Contents
Electronic Lab Notebook
Purpose
The purpose of this experiment is to learn about models and modeling, as well as the central dogma of molecular biology by utilizing the software Aipotu. We will use this software to learn about the real computational work that systems biologists do and emulate that work with hypothetical organisms as a control.
Methods
Task A
- Loaded each allele in to Aipotu
- Created pure-breeding species by continuously self-breeding each initial flower in the Genetics tab.
- Created hybrids between each pure-breeding homozygous flower and a pure-breeding homozygous White flower
- Compared each of these hybrids's DNA seq by using built in compare tool, shown in a screenshot below.
- Compared each of the amino acid sequences by hand, copying the sequence over from the Molecular Bio screen into the table in the Results section.
Task B
- Loaded sample by double-clicking on White flower organism in Greenhouse (molecular biology tab in Aipotu pictured on right).
- Compared sequence using compare tool
Task C
- Loaded each sample into the Molecular Biology tab.
- Examined and recorded the color boxes in bottom right of each sample window for each organism.
Task D
- Created a cross of pure-breeding homozygous Blue flower and pure-breeding homozygous Red flower.
- Compared the proteins synthesized by the co-dominant alleles of the hybrid Purple flower.
- Determined the difference between the two proteins
- Created hypothesis that adding amino acids with aromatic groups (specifically Phenylalanine from the Blue allele) around locations of amino acids with aromatic groups would change color.
- This is also similar in location to the locations where most of the variation between the alleles happens.
- Tested hypothesis
- Recorded result
Results
Task A
*Differences in DNA or protein sequence from that of the white allele are underlined and red.
| Allele | Color | Change(s) in Amino Acid Sequence | Change(s) in DNA Sequence |
|---|---|---|---|
| B | Blue | CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT
|
N-MetSerAsnArgHisIleLeuLeuValTyrCysArgGln-C
|
| R | Red | CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT
|
N-MetSerAsnArgHisIleLeuLeuValPheCysArgGln-C
|
| G | Green | CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT
|
N-MetSerAsnArgHisIleLeuLeuValTyrTrpArgGln-C
|
| Y | Yellow | CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT
|
N-MetSerAsnArgHisIleLeuLeuValTrpCysArgGln-C
|
| W | White | CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT
|
N-MetSerAsnArgHisIleLeuLeuValValCysArgGln-C |
Task B
Given the screenshot on the right, there were no differences in the white alleles.
Task C
The DNA sequences present in each of the starting organisms are given in the table above. The table below describes the allele composition of each of the four starting organisms.
| Organism Name | Allele 1 | Allele 2 |
|---|---|---|
| White | White | White |
| Green-1 | Green | Green |
| Green-2 | Blue | Yellow |
| Red | Red | White |
Task D
A purple flower is created by adding Phenylalanine codon to the DNA that encodes the Red allele, or a Tyrosine codon to the DNA that encodes the Blue protein. An example with the DNA fragment that encodes the Red allele is shown below, with the position of the codon underlined and in red. The amino acid sequence is shown below as well, with the position of the addition of Phenylalanine underlined and in red.
CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTATTTCTGTCGGCAGTAGTAGGGGGCGT
N-MetSerAsnArgHisIleLeuLeuValTyrPheCysArgGln-C
Task E
Task F
Conclusion
Other Links
| Links | ||
|---|---|---|
| Mihir Samdarshi User Page | ||
| Assignment Pages | Personal Journal Entries | Shared Journal Entries |
| Week 1 | Journal Week 1 | Class Journal Week 1 |
| Week 2 | Journal Week 2 | Class Journal Week 2 |
| Week 3 | FAS2/YPL231W Week 3 | Class Journal Week 3 |
| Week 4 | Journal Week 4 | Class Journal Week 4 |
| Week 5 | Database - AmtDB | Class Journal Week 5 |
| Week 6 | Journal Week 6 | Class Journal Week 6 |
| Week 7 | Journal Week 7 | Class Journal Week 7 |
| Week 8 | Journal Week 8 | Class Journal Week 8 |
| Week 9 | Journal Week 9 | Class Journal Week 9 |
| Assignment Pages | Personal Journal Entries | |
| Week 10 | Journal Week 10 | |
| Week 11 | Journal Week 11 | |
| Week 12/13 | Journal Week 12/13 | |
| Team Project Links | ||
| Skinny Genes Team Page | ||
Acknowledgement
This week my partner was John Nimmers-Minor. We worked in and out of class together to better understand the questions. I also asked Mike Armas for assistance with Task D, as he was working on the Biochemistry portion of this assignment. Except for what is noted above, this individual journal entry was completed by me and not copied from another source.
References
LMU BioDB 2019. (2019). Week 2. Retrieved September 11, 2019, from https://xmlpipedb.cs.lmu.edu/biodb/fall2019/index.php/Week_2 MediaWiki (2019). Category: Help. Retrieved September 11, 2019, from https://www.mediawiki.org/wiki/Category:Help
